Incidental Mutation 'R4682:Igfn1'
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4682 (G1)
Quality Score225
Status Not validated
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135998625 bp
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: E29G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: E29G

low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017 utr 3 prime probably benign
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1626:Igfn1 UTSW 1 135968967 missense probably benign 0.29
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R1984:Igfn1 UTSW 1 135962044 missense probably benign 0.39
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135964826 missense probably benign
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R5966:Igfn1 UTSW 1 135965414 missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
R7105:Igfn1 UTSW 1 135984218 missense probably benign 0.11
R7114:Igfn1 UTSW 1 135966781 missense probably benign 0.01
R7233:Igfn1 UTSW 1 135970135 missense probably benign 0.41
R7276:Igfn1 UTSW 1 135998638 missense possibly damaging 0.85
R7354:Igfn1 UTSW 1 135976032 missense possibly damaging 0.72
R7358:Igfn1 UTSW 1 135964000 missense probably damaging 1.00
R7380:Igfn1 UTSW 1 135962008 missense probably damaging 1.00
R7389:Igfn1 UTSW 1 135967047 missense probably benign 0.00
R7513:Igfn1 UTSW 1 135959967 missense probably damaging 1.00
R7718:Igfn1 UTSW 1 135969036 missense probably benign
R7769:Igfn1 UTSW 1 135982405 missense possibly damaging 0.85
R7810:Igfn1 UTSW 1 135974789 missense probably damaging 0.98
R8041:Igfn1 UTSW 1 135968059 nonsense probably null
Z1176:Igfn1 UTSW 1 135972000 missense probably damaging 0.99
Z1177:Igfn1 UTSW 1 135955809 missense probably damaging 1.00
Z1177:Igfn1 UTSW 1 135969567 missense probably benign 0.26
Z1177:Igfn1 UTSW 1 135982426 missense possibly damaging 0.73
Predicted Primers
Posted On2015-10-08