Incidental Mutation 'R4682:Anapc1'
ID350069
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4682 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128664005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 637 (V637A)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: V637A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: V637A

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
AA Change: V637A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: V637A

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143007
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 intron probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCAGGTTCTCTCAGTTATATAGCCAG -3'
(R):5'- TAATGTTTGTGCCCAGTGTCC -3'

Sequencing Primer
(F):5'- GCCAGTTATACAAGCACTGCATTTC -3'
(R):5'- GCCCAGTGTCCTTAGTGATAG -3'
Posted On2015-10-08