Incidental Mutation 'R4682:Zfp111'
ID350081
Institutional Source Beutler Lab
Gene Symbol Zfp111
Ensembl Gene ENSMUSG00000087598
Gene Namezinc finger protein 111
Synonyms
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4682 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24193947-24211443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24199138 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 349 (K349N)
Ref Sequence ENSEMBL: ENSMUSP00000083169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056683] [ENSMUST00000073833] [ENSMUST00000086006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056683
AA Change: K350N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129484
Gene: ENSMUSG00000087598
AA Change: K350N

DomainStartEndE-ValueType
KRAB 9 64 1.8e-21 SMART
low complexity region 114 128 N/A INTRINSIC
ZnF_C2H2 210 232 2.3e-7 SMART
ZnF_C2H2 266 288 5.7e-4 SMART
ZnF_C2H2 294 316 3.3e-4 SMART
ZnF_C2H2 322 343 4.3e-1 SMART
ZnF_C2H2 349 371 4.5e-8 SMART
ZnF_C2H2 377 399 2.1e-6 SMART
ZnF_C2H2 405 427 8e-6 SMART
ZnF_C2H2 433 455 9.9e-5 SMART
ZnF_C2H2 461 481 4.3e-2 SMART
ZnF_C2H2 489 511 2.7e-5 SMART
ZnF_C2H2 517 539 1.1e-6 SMART
ZnF_C2H2 545 567 1.8e-5 SMART
ZnF_C2H2 573 595 3.5e-6 SMART
ZnF_C2H2 601 623 2.9e-6 SMART
ZnF_C2H2 629 651 1.3e-6 SMART
ZnF_C2H2 657 679 2.2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073833
AA Change: K349N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083174
Gene: ENSMUSG00000087598
AA Change: K349N

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086006
AA Change: K349N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083169
Gene: ENSMUSG00000087598
AA Change: K349N

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160563
Meta Mutation Damage Score 0.2196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Zfp111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02569:Zfp111 APN 7 24207069 missense possibly damaging 0.91
IGL02619:Zfp111 APN 7 24199688 missense possibly damaging 0.75
FR4737:Zfp111 UTSW 7 24199805 small insertion probably benign
FR4976:Zfp111 UTSW 7 24199037 missense probably damaging 0.97
FR4976:Zfp111 UTSW 7 24199807 small insertion probably benign
R0514:Zfp111 UTSW 7 24199143 missense probably damaging 0.96
R3837:Zfp111 UTSW 7 24199466 missense possibly damaging 0.53
R4844:Zfp111 UTSW 7 24199376 missense probably damaging 0.99
R6105:Zfp111 UTSW 7 24203366 splice site probably null
R6175:Zfp111 UTSW 7 24198129 missense unknown
R7276:Zfp111 UTSW 7 24199553 missense probably damaging 1.00
R7584:Zfp111 UTSW 7 24198600 missense possibly damaging 0.89
X0018:Zfp111 UTSW 7 24199991 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATAAGGCTTGTCCCCTGAG -3'
(R):5'- CGTAGCTCGGATCTCAACATCC -3'

Sequencing Primer
(F):5'- CCTGAGTGCACTCTCTGATGAG -3'
(R):5'- AAGAAGCGCTTCATGCAGTGTTC -3'
Posted On2015-10-08