Incidental Mutation 'R4682:Hdac5'
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4682 (G1)
Quality Score194
Status Validated
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102206630 bp
Amino Acid Change Serine to Glycine at position 158 (S158G)
Ref Sequence ENSEMBL: ENSMUSP00000118108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000131254] [ENSMUST00000131254] [ENSMUST00000156337]
Predicted Effect probably benign
Transcript: ENSMUST00000008999
AA Change: S186G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: S186G

low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107150
AA Change: S167G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: S167G

low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107151
AA Change: S168G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: S168G

low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107152
AA Change: S168G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: S168G

low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

low complexity region 37 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131254
AA Change: S158G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118108
Gene: ENSMUSG00000008855
AA Change: S158G

low complexity region 30 47 N/A INTRINSIC
Pfam:HDAC4_Gln 57 146 1.5e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131254
AA Change: S158G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118108
Gene: ENSMUSG00000008855
AA Change: S158G

low complexity region 30 47 N/A INTRINSIC
Pfam:HDAC4_Gln 57 146 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150683
Predicted Effect probably benign
Transcript: ENSMUST00000156337
AA Change: S126G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116646
Gene: ENSMUSG00000008855
AA Change: S126G

low complexity region 1 15 N/A INTRINSIC
Pfam:HDAC4_Gln 25 114 2e-38 PFAM
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Snai2 T C 16: 14,708,286 V267A probably benign Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
R8140:Hdac5 UTSW 11 102197355 missense probably damaging 1.00
R8151:Hdac5 UTSW 11 102206468 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08