Incidental Mutation 'R4682:Snai2'
ID350090
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Namesnail family zinc finger 2
SynonymsSnail2, Slug, Slugh
MMRRC Submission 041934-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4682 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14705852-14709385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14708286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
Predicted Effect probably benign
Transcript: ENSMUST00000023356
AA Change: V267A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: V267A

DomainStartEndE-ValueType
PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Anapc1 A G 2: 128,664,005 V637A probably benign Het
Aurkc G A 7: 6,995,539 V33M probably null Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dapk1 T A 13: 60,751,147 S810R probably benign Het
Dpm2 C T 2: 32,572,278 probably benign Het
Fgb A T 3: 83,043,265 F394Y probably benign Het
Fry A G 5: 150,422,754 Y1576C probably damaging Het
Gabra4 T C 5: 71,657,809 M1V probably null Het
Grhl1 T G 12: 24,608,433 V359G probably benign Het
Hdac5 T C 11: 102,206,630 S158G probably null Het
Hdgfl1 T C 13: 26,769,247 E281G possibly damaging Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Inpp1 T C 1: 52,794,601 N112S probably benign Het
Itih1 C A 14: 30,937,843 A279S probably damaging Het
Mad1l1 A T 5: 140,300,252 M296K possibly damaging Het
Mark4 T C 7: 19,445,172 probably null Het
Mrpl48 T A 7: 100,549,369 D192V probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nckap5 A T 1: 126,102,542 probably null Het
Nlrp4d T C 7: 10,374,952 T731A noncoding transcript Het
Olfr1428 T C 19: 12,108,685 Y287C probably damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Plekhm3 T C 1: 64,937,927 D128G possibly damaging Het
Ppp1r9a A G 6: 4,905,477 T11A possibly damaging Het
Rnf138 T A 18: 21,010,734 Y112N probably damaging Het
Scn9a A T 2: 66,547,018 V442E probably benign Het
Slc36a4 C A 9: 15,726,848 S190* probably null Het
Slc46a1 A G 11: 78,468,676 K378R possibly damaging Het
Srrm2 T A 17: 23,815,692 S533T probably benign Het
St6galnac4 T A 2: 32,594,099 M103K probably damaging Het
Tap2 C A 17: 34,214,032 Y429* probably null Het
Traf7 T C 17: 24,513,374 K159E probably damaging Het
Zfp111 T G 7: 24,199,138 K349N probably damaging Het
Zfp462 A G 4: 55,011,376 Y1114C probably damaging Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0765:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R0766:Snai2 UTSW 16 14708247 missense possibly damaging 0.71
R1419:Snai2 UTSW 16 14708180 missense possibly damaging 0.85
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R5794:Snai2 UTSW 16 14706726 missense probably benign
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
R8160:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGAAAAGCCTTTCTCTTGCCC -3'
(R):5'- GATGCAATGTGCTTTTCACTTCATC -3'

Sequencing Primer
(F):5'- TTGCCCTCACTGCAATAGGG -3'
(R):5'- GTGCTTTTCACTTCATCTTTAAAGAG -3'
Posted On2015-10-08