Incidental Mutation 'R0267:Dcn'
ID35010
Institutional Source Beutler Lab
Gene Symbol Dcn
Ensembl Gene ENSMUSG00000019929
Gene Namedecorin
SynonymsDC, SLRR1B
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0267 (G1)
Quality Score205
Status Validated
Chromosome10
Chromosomal Location97479609-97518143 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 97506483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105287] [ENSMUST00000163448]
Predicted Effect probably benign
Transcript: ENSMUST00000105287
SMART Domains Protein: ENSMUSP00000100924
Gene: ENSMUSG00000019929

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163448
SMART Domains Protein: ENSMUSP00000131431
Gene: ENSMUSG00000019929

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219539
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate a mature protein product, which is secreted into the extracellular space to regulate collagen fibril assembly. Homozygous knockout mice for this gene exhibit enhanced tumorigenesis in a liver cancer model, and defects in collagen fibrils, leading to weakened skin and tendons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant mice have fragile skin and exhibit abnormal collagen morphology in skin and tendons, supporting this gene's role in regulating collagen fiber formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Dcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Dcn APN 10 97483523 missense probably damaging 1.00
IGL01776:Dcn APN 10 97495076 missense possibly damaging 0.88
IGL02608:Dcn APN 10 97483457 missense probably damaging 0.99
IGL02990:Dcn APN 10 97509973 missense probably benign 0.00
IGL03181:Dcn APN 10 97483452 missense probably damaging 0.98
IGL03268:Dcn APN 10 97483378 missense probably benign
PIT4791001:Dcn UTSW 10 97507742 missense probably benign
R0091:Dcn UTSW 10 97506689 missense probably benign 0.00
R1759:Dcn UTSW 10 97513655 missense probably benign 0.01
R1845:Dcn UTSW 10 97506674 missense probably benign 0.00
R5322:Dcn UTSW 10 97517602 missense probably benign 0.03
R6613:Dcn UTSW 10 97495040 missense probably benign 0.03
R6650:Dcn UTSW 10 97507743 missense probably benign 0.00
R7392:Dcn UTSW 10 97509998 missense probably damaging 0.98
R7596:Dcn UTSW 10 97510009 missense probably damaging 1.00
R7626:Dcn UTSW 10 97483478 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTGAGCCTTAGGAAGACTGGATGATG -3'
(R):5'- CATGGACACGAAGTTCCTGGAGAG -3'

Sequencing Primer
(F):5'- actcccacctccacacac -3'
(R):5'- AGTTCTGGGCATTTTTTCAGGC -3'
Posted On2013-05-09