Incidental Mutation 'R4683:Gm14124'
ID350104
Institutional Source Beutler Lab
Gene Symbol Gm14124
Ensembl Gene ENSMUSG00000079008
Gene Namepredicted gene 14124
Synonyms
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150257517-150270300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150266470 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 50 (H50Q)
Ref Sequence ENSEMBL: ENSMUSP00000105548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109922
AA Change: H50Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008
AA Change: H50Q

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Gm14124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gm14124 APN 2 150266443 splice site probably benign
R0220:Gm14124 UTSW 2 150268675 missense unknown
R0396:Gm14124 UTSW 2 150268053 missense probably damaging 1.00
R0402:Gm14124 UTSW 2 150269216 missense possibly damaging 0.93
R0446:Gm14124 UTSW 2 150268073 missense possibly damaging 0.71
R0462:Gm14124 UTSW 2 150269202 missense possibly damaging 0.80
R0507:Gm14124 UTSW 2 150268124 missense possibly damaging 0.69
R0605:Gm14124 UTSW 2 150268603 missense unknown
R0838:Gm14124 UTSW 2 150269300 missense possibly damaging 0.74
R1327:Gm14124 UTSW 2 150266150 missense possibly damaging 0.71
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R2114:Gm14124 UTSW 2 150267899 missense unknown
R2140:Gm14124 UTSW 2 150269361 missense probably benign 0.33
R3683:Gm14124 UTSW 2 150268056 missense probably benign 0.41
R3917:Gm14124 UTSW 2 150266119 splice site probably benign
R4084:Gm14124 UTSW 2 150266202 missense possibly damaging 0.85
R4499:Gm14124 UTSW 2 150269442 missense possibly damaging 0.93
R4762:Gm14124 UTSW 2 150267629 missense possibly damaging 0.53
R4937:Gm14124 UTSW 2 150268760 missense unknown
R5678:Gm14124 UTSW 2 150268505 nonsense probably null
R5696:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5697:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5698:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5769:Gm14124 UTSW 2 150268278 missense possibly damaging 0.87
R5780:Gm14124 UTSW 2 150266219 missense probably benign 0.05
R5973:Gm14124 UTSW 2 150267935 missense unknown
R6662:Gm14124 UTSW 2 150266252 critical splice donor site probably null
R6878:Gm14124 UTSW 2 150266486 missense possibly damaging 0.86
R7037:Gm14124 UTSW 2 150266456 missense possibly damaging 0.86
R7081:Gm14124 UTSW 2 150268269 missense possibly damaging 0.66
R7413:Gm14124 UTSW 2 150266161 missense possibly damaging 0.93
R7725:Gm14124 UTSW 2 150268548 missense unknown
R7781:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
X0022:Gm14124 UTSW 2 150267658 missense possibly damaging 0.53
Z1177:Gm14124 UTSW 2 150268317 missense possibly damaging 0.84
Z1177:Gm14124 UTSW 2 150268324 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAATCTCGCTGCTATAGGTAA -3'
(R):5'- TGACGTCAGTTTTAGTATGGACT -3'

Sequencing Primer
(F):5'- TCTCGCTGCTATAGGTAAGACAG -3'
(R):5'- ACTGGCAATTCTTCAGCATAGC -3'
Posted On2015-10-08