Incidental Mutation 'R4683:Mrps22'
ID 350119
Institutional Source Beutler Lab
Gene Symbol Mrps22
Ensembl Gene ENSMUSG00000032459
Gene Name mitochondrial ribosomal protein S22
Synonyms 3100002P07Rik, Rpms22
MMRRC Submission 041935-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4683 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 98470783-98483713 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 98480359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035034] [ENSMUST00000035034] [ENSMUST00000035034]
AlphaFold Q9CXW2
Predicted Effect probably null
Transcript: ENSMUST00000035034
SMART Domains Protein: ENSMUSP00000035034
Gene: ENSMUSG00000032459

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Pfam:MRP-S22 67 308 7.5e-111 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035034
SMART Domains Protein: ENSMUSP00000035034
Gene: ENSMUSG00000032459

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Pfam:MRP-S22 67 308 7.5e-111 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035034
SMART Domains Protein: ENSMUSP00000035034
Gene: ENSMUSG00000032459

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Pfam:MRP-S22 67 308 7.5e-111 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that does not seem to have a counterpart in prokaryotic and fungal-mitochondrial ribosomes. This gene lies telomeric of and is transcribed in the opposite direction from the forkhead box L2 gene. A pseudogene corresponding to this gene is found on chromosome Xq. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr3 T C 1: 90,141,709 (GRCm39) V56A probably damaging Het
Acyp1 A G 12: 85,325,717 (GRCm39) probably benign Het
Adgrb1 A T 15: 74,459,963 (GRCm39) K532I probably damaging Het
Ahrr T A 13: 74,372,885 (GRCm39) silent Het
Asz1 T C 6: 18,055,541 (GRCm39) probably benign Het
AW554918 T C 18: 25,472,852 (GRCm39) Y219H probably benign Het
Ccno C A 13: 113,125,543 (GRCm39) probably null Het
Cdh17 A T 4: 11,817,036 (GRCm39) N816Y possibly damaging Het
Clca4a C T 3: 144,660,701 (GRCm39) V708I probably damaging Het
Col6a3 T A 1: 90,701,179 (GRCm39) Y2579F unknown Het
Col6a4 A G 9: 105,957,329 (GRCm39) V165A probably benign Het
Csf1r T A 18: 61,257,983 (GRCm39) C651S probably damaging Het
Cyp4f14 T C 17: 33,126,985 (GRCm39) D315G probably null Het
Def6 A G 17: 28,436,609 (GRCm39) D91G probably damaging Het
Dmxl1 T G 18: 50,011,088 (GRCm39) S1082A probably damaging Het
Dnah2 A T 11: 69,349,768 (GRCm39) Y2392N probably damaging Het
Dsg4 T C 18: 20,594,466 (GRCm39) S532P probably benign Het
Efr3a C A 15: 65,691,650 (GRCm39) S126R probably damaging Het
Gab1 A C 8: 81,515,261 (GRCm39) H352Q probably benign Het
Gm1110 A G 9: 26,831,890 (GRCm39) M87T probably damaging Het
Greb1 C T 12: 16,761,774 (GRCm39) M535I possibly damaging Het
Greb1l T A 18: 10,529,563 (GRCm39) probably null Het
Gucy2d T C 7: 98,102,650 (GRCm39) C487R probably benign Het
H1f7 A T 15: 98,154,921 (GRCm39) I76N probably damaging Het
Lrrc2 A T 9: 110,791,614 (GRCm39) H122L possibly damaging Het
Mxd3 T C 13: 55,473,613 (GRCm39) T202A probably benign Het
Neb T C 2: 52,134,074 (GRCm39) H3303R possibly damaging Het
Nup133 G A 8: 124,657,721 (GRCm39) R405* probably null Het
Or13a19 T C 7: 139,902,681 (GRCm39) L23P probably benign Het
Or14j6 A G 17: 38,215,039 (GRCm39) T201A probably benign Het
Pard3b T C 1: 62,255,675 (GRCm39) Y629H probably benign Het
Pcnx1 A G 12: 82,033,446 (GRCm39) D1781G probably benign Het
Pcsk5 A T 19: 17,450,405 (GRCm39) C1148S probably damaging Het
Pcsk9 A T 4: 106,316,092 (GRCm39) I117N possibly damaging Het
Pcyt1b C A X: 92,789,970 (GRCm39) P318H probably damaging Het
Pfkfb2 T A 1: 130,634,221 (GRCm39) probably null Het
Pi4ka T C 16: 17,114,901 (GRCm39) E1456G possibly damaging Het
Rlig1 T C 10: 100,414,243 (GRCm39) I139V probably benign Het
Sh2b2 C T 5: 136,260,574 (GRCm39) C214Y probably damaging Het
Slc52a2 C A 15: 76,424,433 (GRCm39) P224T probably damaging Het
Slf2 C G 19: 44,923,920 (GRCm39) R245G probably benign Het
Sox5 T C 6: 143,779,193 (GRCm39) S648G probably damaging Het
Stk36 T A 1: 74,673,344 (GRCm39) I1079N probably benign Het
Stxbp3 T C 3: 108,708,188 (GRCm39) D371G probably damaging Het
Trnau1ap A T 4: 132,049,063 (GRCm39) Y47N probably damaging Het
Ubr5 C T 15: 38,038,211 (GRCm39) R316H probably damaging Het
Vmn1r230 C T 17: 21,067,515 (GRCm39) R235C probably benign Het
Wnt10a C T 1: 74,842,296 (GRCm39) H93Y unknown Het
Zfp1005 T A 2: 150,108,390 (GRCm39) H50Q possibly damaging Het
Zfp52 A G 17: 21,781,769 (GRCm39) D539G probably benign Het
Other mutations in Mrps22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Mrps22 APN 9 98,479,034 (GRCm39) missense possibly damaging 0.83
R0562:Mrps22 UTSW 9 98,474,746 (GRCm39) missense probably benign 0.04
R1241:Mrps22 UTSW 9 98,476,748 (GRCm39) missense probably benign 0.01
R1672:Mrps22 UTSW 9 98,478,869 (GRCm39) splice site probably null
R6332:Mrps22 UTSW 9 98,483,524 (GRCm39) critical splice donor site probably null
R7144:Mrps22 UTSW 9 98,483,524 (GRCm39) critical splice donor site probably null
R8917:Mrps22 UTSW 9 98,476,163 (GRCm39) missense probably benign 0.31
R9502:Mrps22 UTSW 9 98,480,219 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGTTGACATACCTCTTCCAAC -3'
(R):5'- TGGTGCTCACTGTAGTAGACC -3'

Sequencing Primer
(F):5'- CAACTGTGCCTGTGTCATTAAC -3'
(R):5'- GTAGTAGACCATCTTCTTGGCAGAC -3'
Posted On 2015-10-08