Incidental Mutation 'R0267:Zfp692'
ID 35012
Institutional Source Beutler Lab
Gene Symbol Zfp692
Ensembl Gene ENSMUSG00000037243
Gene Name zinc finger protein 692
Synonyms Zfp692-ps
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0267 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58307069-58314627 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58314314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 463 (V463E)
Ref Sequence ENSEMBL: ENSMUSP00000126674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000057836] [ENSMUST00000064786] [ENSMUST00000108829] [ENSMUST00000153510] [ENSMUST00000155662] [ENSMUST00000186859]
AlphaFold Q3U381
Predicted Effect possibly damaging
Transcript: ENSMUST00000049353
AA Change: V463E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243
AA Change: V463E

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057836
SMART Domains Protein: ENSMUSP00000060088
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064786
SMART Domains Protein: ENSMUSP00000070567
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108829
SMART Domains Protein: ENSMUSP00000104457
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153510
AA Change: V463E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243
AA Change: V463E

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155662
SMART Domains Protein: ENSMUSP00000114561
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186859
SMART Domains Protein: ENSMUSP00000140236
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 1.8e-5 SMART
ZnF_C2H2 43 65 3.6e-2 SMART
ZnF_C2H2 71 90 6.1e-1 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Zfp692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Zfp692 APN 11 58314029 missense possibly damaging 0.94
IGL00978:Zfp692 APN 11 58309998 missense possibly damaging 0.92
IGL01667:Zfp692 APN 11 58311553 missense probably damaging 1.00
IGL02209:Zfp692 APN 11 58313998 nonsense probably null
IGL02873:Zfp692 APN 11 58308939 missense probably damaging 1.00
R0255:Zfp692 UTSW 11 58310403 splice site probably benign
R0506:Zfp692 UTSW 11 58309055 nonsense probably null
R0554:Zfp692 UTSW 11 58314227 missense probably damaging 1.00
R0628:Zfp692 UTSW 11 58309623 missense probably damaging 1.00
R0712:Zfp692 UTSW 11 58314314 missense probably benign 0.00
R1112:Zfp692 UTSW 11 58311562 missense probably damaging 1.00
R1493:Zfp692 UTSW 11 58314040 missense probably damaging 1.00
R1768:Zfp692 UTSW 11 58310176 splice site probably benign
R1853:Zfp692 UTSW 11 58309979 missense possibly damaging 0.69
R3551:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R3552:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R4281:Zfp692 UTSW 11 58314265 missense probably damaging 1.00
R4784:Zfp692 UTSW 11 58310171 missense probably null 0.12
R5150:Zfp692 UTSW 11 58307587 start codon destroyed probably null 0.77
R7035:Zfp692 UTSW 11 58309442 critical splice donor site probably null
R7343:Zfp692 UTSW 11 58311505 missense probably damaging 1.00
R7896:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R8071:Zfp692 UTSW 11 58307734 missense probably damaging 0.96
R8163:Zfp692 UTSW 11 58310373 splice site probably null
R9043:Zfp692 UTSW 11 58307724 missense probably damaging 0.98
Z1186:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1186:Zfp692 UTSW 11 58310018 missense probably benign
Z1187:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1187:Zfp692 UTSW 11 58310018 missense probably benign
Z1188:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1188:Zfp692 UTSW 11 58310018 missense probably benign
Z1189:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1189:Zfp692 UTSW 11 58310018 missense probably benign
Z1190:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1190:Zfp692 UTSW 11 58310018 missense probably benign
Z1191:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1191:Zfp692 UTSW 11 58310018 missense probably benign
Z1192:Zfp692 UTSW 11 58309033 missense probably benign 0.02
Z1192:Zfp692 UTSW 11 58310018 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGATCTTTCCGCACTAGCAGCAAC -3'
(R):5'- TGGCACCCCAGGTGAAGAAATG -3'

Sequencing Primer
(F):5'- AGGGAGCTATTATCTGGCAGC -3'
(R):5'- CCCAGGTGAAGAAATGGATGTTG -3'
Posted On 2013-05-09