Incidental Mutation 'R4683:Pcnx'
ID350126
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81986672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1781 (D1781G)
Ref Sequence ENSEMBL: ENSMUSP00000152104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably benign
Transcript: ENSMUST00000021567
AA Change: D1787G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: D1787G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221675
AA Change: D1148G
Predicted Effect probably benign
Transcript: ENSMUST00000221721
AA Change: D1781G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
ihop UTSW 12 81971376 missense probably benign 0.09
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- TCCTCCAAGACAGCGTTCTG -3'
(R):5'- AACTTAATTAGTTTAGGTCGGAGGGAG -3'

Sequencing Primer
(F):5'- CTATCTCTGACTTATTGATTGG -3'
(R):5'- TACAGATGGTTGTGAGCCACC -3'
Posted On2015-10-08