Incidental Mutation 'R4683:Acyp1'
ID350127
Institutional Source Beutler Lab
Gene Symbol Acyp1
Ensembl Gene ENSMUSG00000008822
Gene Nameacylphosphatase 1, erythrocyte (common) type
Synonyms
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85272398-85288438 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 85278943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000065913] [ENSMUST00000117138] [ENSMUST00000121930]
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000065913
AA Change: I94T
SMART Domains Protein: ENSMUSP00000070555
Gene: ENSMUSG00000008822
AA Change: I94T

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 35 5.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Acyp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1204:Acyp1 UTSW 12 85280092 splice site probably null
R1898:Acyp1 UTSW 12 85288340 missense probably benign 0.00
R5336:Acyp1 UTSW 12 85280011 missense probably damaging 1.00
R5392:Acyp1 UTSW 12 85278985 intron probably benign
R6747:Acyp1 UTSW 12 85278905 missense probably null
R7075:Acyp1 UTSW 12 85279008 missense unknown
R7746:Acyp1 UTSW 12 85279058 missense unknown
R7794:Acyp1 UTSW 12 85288279 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACCTGGAGTGTCTGACGAC -3'
(R):5'- TCCAAATTATCTGGAGTAGCACGT -3'

Sequencing Primer
(F):5'- TGTCTGACGACAGCTACAGTGTAC -3'
(R):5'- TCCTTGTCTTATCACCAAGGAACAG -3'
Posted On2015-10-08