Incidental Mutation 'R4683:Ccno'
ID350129
Institutional Source Beutler Lab
Gene Symbol Ccno
Ensembl Gene ENSMUSG00000042417
Gene Namecyclin O
SynonymsUng2, Ccnu
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112987802-112990777 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 112989009 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038404] [ENSMUST00000092089]
Predicted Effect probably damaging
Transcript: ENSMUST00000038404
AA Change: T169K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040083
Gene: ENSMUSG00000042417
AA Change: T169K

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
CYCLIN 140 224 1.23e-19 SMART
Cyclin_C 233 350 3.49e-7 SMART
CYCLIN 244 327 5.77e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092089
SMART Domains Protein: ENSMUSP00000089721
Gene: ENSMUSG00000074651

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Pfam:Geminin 169 258 4.8e-20 PFAM
low complexity region 262 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225555
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin protein family, and the encoded protein is involved in regulation of the cell cycle. Disruption of this gene is associated with primary ciliary dyskinesia-19. Alternative splicing results in multiple transcript variants. This gene, which has a previous symbol of UNG2, was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication, PubMed ID: 8419333, identified this gene's product as a cyclin protein family member. The UNG2 symbol is also used as a specific protein isoform name for the UNG gene (GeneID 7374), so confusion exists in the scientific literature and in some databases for these two genes. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pre-weaning lethality after E17, hydrocephaly, growth retardation, enlarged brain ventricles, thin cerebral cortex, nasal cavity congestion and impaired formation of deuterosomes and centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Ccno
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Ccno APN 13 112989027 missense probably damaging 1.00
IGL02875:Ccno APN 13 112988052 missense possibly damaging 0.91
R0193:Ccno UTSW 13 112988884 unclassified probably benign
R0329:Ccno UTSW 13 112989996 missense probably damaging 1.00
R0330:Ccno UTSW 13 112989996 missense probably damaging 1.00
R0387:Ccno UTSW 13 112989867 missense probably damaging 1.00
R0556:Ccno UTSW 13 112988286 critical splice donor site probably null
R4197:Ccno UTSW 13 112989069 missense probably damaging 0.99
R4825:Ccno UTSW 13 112988099 missense probably benign 0.14
R6180:Ccno UTSW 13 112989845 missense probably damaging 1.00
R6574:Ccno UTSW 13 112988185 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACTGTGCACAATACCAGG -3'
(R):5'- TCTGCCCAGATAAGCCAAGC -3'

Sequencing Primer
(F):5'- AAACGTTCCCAGGCGTTC -3'
(R):5'- GATAAGCCAAGCAACCCAGC -3'
Posted On2015-10-08