Incidental Mutation 'R4683:Def6'
ID350138
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Namedifferentially expressed in FDCP 6
SynonymsIBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4683 (G1)
Quality Score188
Status Not validated
Chromosome17
Chromosomal Location28207778-28228608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28217635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002327]
Predicted Effect probably damaging
Transcript: ENSMUST00000002327
AA Change: D91G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28219740 splice site probably benign
IGL01619:Def6 APN 17 28207864 missense probably damaging 1.00
IGL01737:Def6 APN 17 28223727 missense possibly damaging 0.94
IGL02550:Def6 APN 17 28228261 missense probably benign 0.03
R0013:Def6 UTSW 17 28217092 missense probably damaging 1.00
R0335:Def6 UTSW 17 28228069 missense possibly damaging 0.83
R0357:Def6 UTSW 17 28223935 missense probably damaging 1.00
R0373:Def6 UTSW 17 28220180 missense probably damaging 0.96
R1161:Def6 UTSW 17 28217619 missense probably benign 0.00
R1310:Def6 UTSW 17 28217619 missense probably benign 0.00
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1636:Def6 UTSW 17 28223918 missense possibly damaging 0.95
R1778:Def6 UTSW 17 28220186 missense probably benign 0.02
R2432:Def6 UTSW 17 28228069 missense probably benign 0.03
R3881:Def6 UTSW 17 28220215 missense probably damaging 1.00
R4402:Def6 UTSW 17 28219976 missense probably damaging 0.99
R4589:Def6 UTSW 17 28228147 missense probably benign
R5704:Def6 UTSW 17 28228226 missense probably benign
R6481:Def6 UTSW 17 28226163 missense probably benign 0.00
R6805:Def6 UTSW 17 28223717 missense probably damaging 1.00
R7029:Def6 UTSW 17 28225969 missense probably benign 0.05
R7863:Def6 UTSW 17 28227867 missense possibly damaging 0.62
R8229:Def6 UTSW 17 28217755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCCAACTTTGAGTTCAG -3'
(R):5'- GAACGCCCAATGATACTCTGTC -3'

Sequencing Primer
(F):5'- AGCCAACTTTGAGTTCAGTCTTG -3'
(R):5'- TCAGTGACTCCACCGTCTGG -3'
Posted On2015-10-08