Incidental Mutation 'R0267:Appbp2'
ID35014
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Nameamyloid beta precursor protein (cytoplasmic tail) binding protein 2
SynonymsPAT1, 1300003O07Rik
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R0267 (G1)
Quality Score186
Status Validated
Chromosome11
Chromosomal Location85187262-85235130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85201462 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 297 (Y297C)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
Predicted Effect probably damaging
Transcript: ENSMUST00000018625
AA Change: Y297C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: Y297C

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Meta Mutation Damage Score 0.2004 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85214317 missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85201620 missense probably benign 0.04
IGL03051:Appbp2 APN 11 85191739 missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85201420 missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85216457 missense probably benign 0.00
IGL03358:Appbp2 APN 11 85210034 missense probably benign 0.17
R0017:Appbp2 UTSW 11 85214303 missense possibly damaging 0.46
R0504:Appbp2 UTSW 11 85191687 missense probably benign 0.05
R1661:Appbp2 UTSW 11 85210110 critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85198140 missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85198108 missense probably damaging 1.00
R3950:Appbp2 UTSW 11 85194706 missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85234676 missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85209938 critical splice donor site probably null
R4948:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85196064 critical splice donor site probably null
R5581:Appbp2 UTSW 11 85210095 missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5698:Appbp2 UTSW 11 85210099 missense probably damaging 1.00
R7095:Appbp2 UTSW 11 85234727 nonsense probably null
R7141:Appbp2 UTSW 11 85191751 nonsense probably null
X0058:Appbp2 UTSW 11 85201630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGATGGTTTCAATCCTGAACG -3'
(R):5'- CATGCAGTGTATTTGGCACGGTAAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CACGGTAAGTGATTGTTACTCAAGG -3'
Posted On2013-05-09