Incidental Mutation 'R4683:AW554918'
ID350143
Institutional Source Beutler Lab
Gene Symbol AW554918
Ensembl Gene ENSMUSG00000033632
Gene Nameexpressed sequence AW554918
Synonyms
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location25168999-25467321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25339795 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 219 (Y219H)
Ref Sequence ENSEMBL: ENSMUSP00000095248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000100131] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect probably benign
Transcript: ENSMUST00000036619
AA Change: Y219H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632
AA Change: Y219H

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097643
AA Change: Y219H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632
AA Change: Y219H

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100131
AA Change: Y16H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097708
Gene: ENSMUSG00000033632
AA Change: Y16H

DomainStartEndE-ValueType
Pfam:KIAA1328 1 211 9.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect probably benign
Transcript: ENSMUST00000165400
AA Change: Y219H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632
AA Change: Y219H

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Slf2 C G 19: 44,935,481 R245G probably benign Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in AW554918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:AW554918 APN 18 25420065 nonsense probably null
IGL01443:AW554918 APN 18 25344955 missense probably damaging 1.00
IGL01973:AW554918 APN 18 25419999 missense probably damaging 1.00
IGL02743:AW554918 APN 18 25289944 nonsense probably null
PIT4802001:AW554918 UTSW 18 25340075 missense possibly damaging 0.90
R0081:AW554918 UTSW 18 25344902 missense probably benign 0.00
R0567:AW554918 UTSW 18 25400035 missense possibly damaging 0.83
R0709:AW554918 UTSW 18 25463654 missense probably damaging 1.00
R1052:AW554918 UTSW 18 25420010 missense probably benign 0.05
R1418:AW554918 UTSW 18 25339699 splice site probably null
R1530:AW554918 UTSW 18 25400104 missense probably damaging 0.97
R2406:AW554918 UTSW 18 25340287 missense possibly damaging 0.95
R3414:AW554918 UTSW 18 25400072 missense possibly damaging 0.76
R3815:AW554918 UTSW 18 25400047 missense probably benign 0.42
R4722:AW554918 UTSW 18 25174715 nonsense probably null
R4843:AW554918 UTSW 18 25340000 missense probably benign 0.00
R5199:AW554918 UTSW 18 25340299 missense probably damaging 1.00
R5279:AW554918 UTSW 18 25175431 missense possibly damaging 0.95
R5580:AW554918 UTSW 18 25339865 missense probably damaging 1.00
R7259:AW554918 UTSW 18 25289849 intron probably null
R7388:AW554918 UTSW 18 25340113 missense probably benign 0.05
R7399:AW554918 UTSW 18 25169060 missense possibly damaging 0.67
R8249:AW554918 UTSW 18 25339718 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCCCTATAGCTTTGCTGAAAGATAG -3'
(R):5'- GCATTTATTAGTCTTCTCCCCAGAG -3'

Sequencing Primer
(F):5'- GGATGTTGCTTTATAAACATTGACGG -3'
(R):5'- TCTCCCCAGAGATTCATAAGTACATG -3'
Posted On2015-10-08