Incidental Mutation 'R4683:Slf2'
ID350147
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene NameSMC5-SMC6 complex localization factor 2
SynonymsFam178a, 6030443O07Rik
MMRRC Submission 041935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R4683 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44931119-44983787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 44935481 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 245 (R245G)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
Predicted Effect probably benign
Transcript: ENSMUST00000096053
AA Change: R245G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: R245G

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Ackr3 T C 1: 90,213,987 V56A probably damaging Het
Acyp1 A G 12: 85,278,943 probably benign Het
Adgrb1 A T 15: 74,588,114 K532I probably damaging Het
Ahrr T A 13: 74,224,766 silent Het
Asz1 T C 6: 18,055,542 probably benign Het
AW554918 T C 18: 25,339,795 Y219H probably benign Het
Ccno C A 13: 112,989,009 probably null Het
Cdh17 A T 4: 11,817,036 N816Y possibly damaging Het
Clca4a C T 3: 144,954,940 V708I probably damaging Het
Col6a3 T A 1: 90,773,457 Y2579F unknown Het
Col6a4 A G 9: 106,080,130 V165A probably benign Het
Csf1r T A 18: 61,124,911 C651S probably damaging Het
Cyp4f14 T C 17: 32,908,011 D315G probably null Het
Def6 A G 17: 28,217,635 D91G probably damaging Het
Dmxl1 T G 18: 49,878,021 S1082A probably damaging Het
Dnah2 A T 11: 69,458,942 Y2392N probably damaging Het
Dsg4 T C 18: 20,461,409 S532P probably benign Het
Efr3a C A 15: 65,819,801 S126R probably damaging Het
Gab1 A C 8: 80,788,632 H352Q probably benign Het
Gm1110 A G 9: 26,920,594 M87T probably damaging Het
Gm14124 T A 2: 150,266,470 H50Q possibly damaging Het
Greb1 C T 12: 16,711,773 M535I possibly damaging Het
Greb1l T A 18: 10,529,563 probably null Het
Gucy2d T C 7: 98,453,443 C487R probably benign Het
H1fnt A T 15: 98,257,040 I76N probably damaging Het
Lrrc2 A T 9: 110,962,546 H122L possibly damaging Het
Mrps22 A T 9: 98,598,306 probably null Het
Mxd3 T C 13: 55,325,800 T202A probably benign Het
Neb T C 2: 52,244,062 H3303R possibly damaging Het
Nup133 G A 8: 123,930,982 R405* probably null Het
Olfr127 A G 17: 37,904,148 T201A probably benign Het
Olfr525 T C 7: 140,322,768 L23P probably benign Het
Pard3b T C 1: 62,216,516 Y629H probably benign Het
Pcnx A G 12: 81,986,672 D1781G probably benign Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Pcsk9 A T 4: 106,458,895 I117N possibly damaging Het
Pcyt1b C A X: 93,746,364 P318H probably damaging Het
Pfkfb2 T A 1: 130,706,484 probably null Het
Pi4ka T C 16: 17,297,037 E1456G possibly damaging Het
Sh2b2 C T 5: 136,231,720 C214Y probably damaging Het
Slc52a2 C A 15: 76,540,233 P224T probably damaging Het
Sox5 T C 6: 143,833,467 S648G probably damaging Het
Stk36 T A 1: 74,634,185 I1079N probably benign Het
Stxbp3 T C 3: 108,800,872 D371G probably damaging Het
Trnau1ap A T 4: 132,321,752 Y47N probably damaging Het
Ubr5 C T 15: 38,037,967 R316H probably damaging Het
Vmn1r230 C T 17: 20,847,253 R235C probably benign Het
Wnt10a C T 1: 74,803,137 H93Y unknown Het
Zfp52 A G 17: 21,561,507 D539G probably benign Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44973267 critical splice donor site probably null
IGL01904:Slf2 APN 19 44949141 critical splice donor site probably null
IGL02429:Slf2 APN 19 44941728 missense probably benign
IGL02899:Slf2 APN 19 44942020 missense probably benign 0.26
R0060:Slf2 UTSW 19 44948004 missense probably damaging 1.00
R0731:Slf2 UTSW 19 44975726 splice site probably benign
R1158:Slf2 UTSW 19 44931416 missense probably damaging 0.99
R1590:Slf2 UTSW 19 44942073 nonsense probably null
R1608:Slf2 UTSW 19 44949001 missense probably benign 0.08
R1823:Slf2 UTSW 19 44935248 missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44941606 missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44980569 missense probably damaging 0.99
R3236:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3237:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3552:Slf2 UTSW 19 44934951 nonsense probably null
R3754:Slf2 UTSW 19 44973237 missense probably benign
R4757:Slf2 UTSW 19 44935058 missense probably benign
R4782:Slf2 UTSW 19 44934925 splice site probably null
R4914:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4915:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4916:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4917:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4918:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R5069:Slf2 UTSW 19 44935253 missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44952084 missense probably benign 0.14
R5215:Slf2 UTSW 19 44948037 missense probably damaging 0.99
R5276:Slf2 UTSW 19 44935161 missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44973235 missense probably benign 0.13
R6132:Slf2 UTSW 19 44960861 missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44935425 missense probably benign 0.34
R6481:Slf2 UTSW 19 44973164 missense probably benign 0.01
R6809:Slf2 UTSW 19 44943468 missense probably damaging 0.98
R7263:Slf2 UTSW 19 44938424 splice site probably null
R7912:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R7993:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R8006:Slf2 UTSW 19 44942317 missense probably damaging 0.99
Z1176:Slf2 UTSW 19 44941665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAGAGAAGGAAGTCACTG -3'
(R):5'- GATTACTCTTCCCAGGTACAGCC -3'

Sequencing Primer
(F):5'- GAGAAGGAAGTCACTGTTCATTC -3'
(R):5'- ACAGCCTCAGTGTGCTTG -3'
Posted On2015-10-08