Incidental Mutation 'R4645:Ly96'
ID350149
Institutional Source Beutler Lab
Gene Symbol Ly96
Ensembl Gene ENSMUSG00000025779
Gene Namelymphocyte antigen 96
SynonymsMD-2, ESOP-1, MD2, myeloid differentiation factor-2
MMRRC Submission 041906-MU
Accession Numbers

Ncbi RefSeq: NM_016923; MGI: 1341909

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location16688051-16709611 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 16691716 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 49 (E49*)
Ref Sequence ENSEMBL: ENSMUSP00000140411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026881] [ENSMUST00000190366]
Predicted Effect probably null
Transcript: ENSMUST00000026881
AA Change: E49*
SMART Domains Protein: ENSMUSP00000026881
Gene: ENSMUSG00000025779
AA Change: E49*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
ML 34 153 7.82e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190366
AA Change: E49*
SMART Domains Protein: ENSMUSP00000140411
Gene: ENSMUSG00000025779
AA Change: E49*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:E1_DerP2_DerF2 66 137 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191260
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired responsiveness to LPS, are resistant to LPS-induced lethal toxicity but show increased susceptibility to Salmonella typhimurium infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Ly96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ly96 APN 1 16706228 splice site probably null
IGL01588:Ly96 APN 1 16709454 missense probably benign 0.11
pique UTSW 1 16691716 nonsense probably null
H8562:Ly96 UTSW 1 16691694 missense probably damaging 1.00
R1186:Ly96 UTSW 1 16700894 missense possibly damaging 0.90
R1751:Ly96 UTSW 1 16706175 missense probably benign 0.00
R1767:Ly96 UTSW 1 16706175 missense probably benign 0.00
R5189:Ly96 UTSW 1 16700867 missense probably damaging 1.00
R5470:Ly96 UTSW 1 16709486 missense probably benign 0.16
R7031:Ly96 UTSW 1 16688563 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCCTGCATGTGACCATAACAG -3'
(R):5'- AAGGCCCATGTATCCAACAG -3'

Sequencing Primer
(F):5'- CATGTGACCATAACAGAGTGGACC -3'
(R):5'- CTTTATAAGGGGCCCTGAATGAC -3'
Posted On2015-10-08