Incidental Mutation 'R4645:Olfr1188'
ID350154
Institutional Source Beutler Lab
Gene Symbol Olfr1188
Ensembl Gene ENSMUSG00000068809
Gene Nameolfactory receptor 1188
SynonymsMOR238-2, GA_x6K02T2Q125-50046879-50047784
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88556935-88560815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88560378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 292 (I292T)
Ref Sequence ENSEMBL: ENSMUSP00000150850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090701] [ENSMUST00000217131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090701
AA Change: I303T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088202
Gene: ENSMUSG00000068809
AA Change: I303T

DomainStartEndE-ValueType
Pfam:7tm_4 36 309 5.9e-49 PFAM
Pfam:7tm_1 46 292 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217131
AA Change: I292T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Olfr1188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Olfr1188 APN 2 88560065 missense probably benign 0.02
R1525:Olfr1188 UTSW 2 88559641 missense probably damaging 1.00
R1530:Olfr1188 UTSW 2 88559483 missense probably benign 0.23
R1703:Olfr1188 UTSW 2 88560255 missense possibly damaging 0.56
R1750:Olfr1188 UTSW 2 88560058 missense possibly damaging 0.94
R4626:Olfr1188 UTSW 2 88559832 missense possibly damaging 0.69
R4934:Olfr1188 UTSW 2 88559586 missense probably benign 0.00
R5643:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R5644:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R6539:Olfr1188 UTSW 2 88559520 missense probably damaging 1.00
R7079:Olfr1188 UTSW 2 88559509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGCCCTCTCTACCTGTGG -3'
(R):5'- TGCTAATGACTGCACCATACC -3'

Sequencing Primer
(F):5'- GTGGCTCTCACATCACAGTTG -3'
(R):5'- CCATACCATACATAGAAACAGGTTG -3'
Posted On2015-10-08