Incidental Mutation 'R4645:Zscan4e'
ID350165
Institutional Source Beutler Lab
Gene Symbol Zscan4e
Ensembl Gene ENSMUSG00000095936
Gene Namezinc finger and SCAN domain containing 4E
SynonymsEG665848
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4645 (G1)
Quality Score161
Status Validated
Chromosome7
Chromosomal Location11306378-11310682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11307075 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 290 (Y290C)
Ref Sequence ENSEMBL: ENSMUSP00000147356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166753] [ENSMUST00000210521]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116700
Predicted Effect possibly damaging
Transcript: ENSMUST00000166753
AA Change: Y290C

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125906
Gene: ENSMUSG00000095936
AA Change: Y290C

DomainStartEndE-ValueType
Pfam:SCAN 43 122 5e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166753
AA Change: Y290C

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210521
AA Change: Y290C

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Zscan4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Zscan4e APN 7 11307532 missense probably benign 0.02
R0295:Zscan4e UTSW 7 11307616 missense probably damaging 1.00
R4105:Zscan4e UTSW 7 11307510 missense probably benign 0.01
R7308:Zscan4e UTSW 7 11307153 missense probably benign
R7371:Zscan4e UTSW 7 11307324 missense probably benign
R7396:Zscan4e UTSW 7 11307075 missense probably benign 0.27
R7643:Zscan4e UTSW 7 11309525 missense probably damaging 0.99
R7767:Zscan4e UTSW 7 11307534 missense probably damaging 0.98
Z1176:Zscan4e UTSW 7 11306979 missense probably damaging 1.00
Z1177:Zscan4e UTSW 7 11307625 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TAGACTGCAACCCTGGTACC -3'
(R):5'- GTTTGTCAATTCCCTCGTGG -3'

Sequencing Primer
(F):5'- GGGTCTTTTTCAGAAAAACATTCCCC -3'
(R):5'- AATTCCCTCGTGGTGCCAGAAG -3'
Posted On2015-10-08