Incidental Mutation 'R4645:Thap1'
ID350171
Institutional Source Beutler Lab
Gene Symbol Thap1
Ensembl Gene ENSMUSG00000037214
Gene NameTHAP domain containing, apoptosis associated protein 1
Synonyms4833431A01Rik
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location26158141-26164151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26162569 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 135 (T135A)
Ref Sequence ENSEMBL: ENSMUSP00000042464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036807] [ENSMUST00000130231] [ENSMUST00000131138]
Predicted Effect probably damaging
Transcript: ENSMUST00000036807
AA Change: T135A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042464
Gene: ENSMUSG00000037214
AA Change: T135A

DomainStartEndE-ValueType
THAP 3 86 6.6e-20 SMART
DM3 22 86 3.01e-16 SMART
low complexity region 93 108 N/A INTRINSIC
coiled coil region 137 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127536
Predicted Effect probably benign
Transcript: ENSMUST00000130231
AA Change: T112A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121153
Gene: ENSMUSG00000037214
AA Change: T112A

DomainStartEndE-ValueType
DM3 2 63 1.13e-11 SMART
THAP 2 63 6.77e-8 SMART
low complexity region 70 85 N/A INTRINSIC
SCOP:d1lxa__ 121 173 8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131138
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209926
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO is embryonic lethal. Heterozygous KO affects motor control and the morphology of the cerebellum dentate nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Thap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Thap1 APN 8 26160882 missense possibly damaging 0.74
IGL00990:Thap1 APN 8 26162731 missense probably benign 0.21
IGL02491:Thap1 APN 8 26160857 missense probably damaging 0.97
IGL03097:Thap1 UTSW 8 26162470 missense probably benign
IGL03098:Thap1 UTSW 8 26162470 missense probably benign
R0755:Thap1 UTSW 8 26158473 missense probably damaging 1.00
R0927:Thap1 UTSW 8 26162705 missense probably benign 0.00
R4661:Thap1 UTSW 8 26160846 missense probably benign 0.04
R4803:Thap1 UTSW 8 26160854 frame shift probably null
R4978:Thap1 UTSW 8 26160854 frame shift probably null
R6424:Thap1 UTSW 8 26160856 frame shift probably null
R6447:Thap1 UTSW 8 26160856 frame shift probably null
R6503:Thap1 UTSW 8 26160856 frame shift probably null
R6995:Thap1 UTSW 8 26162651 missense probably damaging 1.00
R7169:Thap1 UTSW 8 26160856 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTTACTAACCCCACGTGCTTG -3'
(R):5'- AGTCTTGTCCCACTAACACATC -3'

Sequencing Primer
(F):5'- GTCTGTTGCTGTCTAGAAGGAAGACC -3'
(R):5'- CATTTGGTAGGATCACGTAGCCC -3'
Posted On2015-10-08