Incidental Mutation 'R4645:Mpi'
ID350173
Institutional Source Beutler Lab
Gene Symbol Mpi
Ensembl Gene ENSMUSG00000032306
Gene Namemannose phosphate isomerase
Synonyms1110002E17Rik, Mpi-1, Mpi1
MMRRC Submission 041906-MU
Accession Numbers

Genbank: NM_025837; MGI: 97075

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57544256-57552763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57550757 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 54 (H54R)
Ref Sequence ENSEMBL: ENSMUSP00000034856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034856]
Predicted Effect probably damaging
Transcript: ENSMUST00000034856
AA Change: H54R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034856
Gene: ENSMUSG00000032306
AA Change: H54R

DomainStartEndE-ValueType
Pfam:PMI_typeI 6 384 4.3e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145543
Predicted Effect unknown
Transcript: ENSMUST00000156428
AA Change: H50R
SMART Domains Protein: ENSMUSP00000119342
Gene: ENSMUSG00000032306
AA Change: H50R

DomainStartEndE-ValueType
Pfam:PMI_typeI 3 119 3.1e-45 PFAM
Meta Mutation Damage Score 0.9748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, variable abnormalities of the yolk sac and embryonic vasculature, and partial penetrance of abnormal chorioallantoic fusion, placental defects, impaired emrbyo turning, increased apoptosis, and posterior axial truncations. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Mpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Mpi APN 9 57552266 missense probably damaging 1.00
IGL01071:Mpi APN 9 57550592 missense probably damaging 1.00
IGL01604:Mpi APN 9 57550742 missense possibly damaging 0.85
IGL02090:Mpi APN 9 57550653 missense probably benign 0.00
benadryl UTSW 9 57550757 missense probably damaging 1.00
sleepies UTSW 9 57545189 unclassified probably benign
Zyrtec UTSW 9 57545217 missense probably damaging 1.00
F6893:Mpi UTSW 9 57546549 missense probably benign 0.12
R0751:Mpi UTSW 9 57550614 missense probably damaging 1.00
R1146:Mpi UTSW 9 57545189 unclassified probably benign
R3727:Mpi UTSW 9 57544849 missense possibly damaging 0.69
R3944:Mpi UTSW 9 57545253 missense probably damaging 1.00
R4772:Mpi UTSW 9 57544898 missense probably damaging 1.00
R4856:Mpi UTSW 9 57545307 missense probably damaging 1.00
R5088:Mpi UTSW 9 57550604 missense probably damaging 0.97
R5504:Mpi UTSW 9 57545217 missense probably damaging 1.00
R5886:Mpi UTSW 9 57548462 unclassified probably benign
R7038:Mpi UTSW 9 57545217 missense probably damaging 1.00
R8043:Mpi UTSW 9 57550598 missense probably damaging 1.00
RF013:Mpi UTSW 9 57548641 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GATCCCGTACCTTGTTAGGGTG -3'
(R):5'- TCTATTGTTGAGACTCATGCTTTCG -3'

Sequencing Primer
(F):5'- AGGGTGTGCCTGGATAGAC -3'
(R):5'- AGACTCATGCTTTCGGAGAC -3'
Posted On2015-10-08