Incidental Mutation 'R4645:Ccr9'
ID350175
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123779593 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 101 (M101I)
Ref Sequence ENSEMBL: ENSMUSP00000107081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: M101I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: M101I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: M113I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: M113I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: M113I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: M113I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: M113I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: M113I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: M113I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: M113I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
hamlet UTSW 9 123779439 missense probably damaging 1.00
Laertes UTSW 9 123779846 missense probably damaging 1.00
Ophelia UTSW 9 123779469 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
R8154:Ccr9 UTSW 9 123779831 missense probably benign 0.00
R8283:Ccr9 UTSW 9 123779631 missense probably damaging 1.00
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCTGTACTGGCTTGTG -3'
(R):5'- CCCACTGACTTGACTGTACAGG -3'

Sequencing Primer
(F):5'- CCTCTGTACTGGCTTGTGTTCATTG -3'
(R):5'- CACTGACTTGACTGTACAGGATTTC -3'
Posted On2015-10-08