Incidental Mutation 'R4645:Glud1'
ID350185
Institutional Source Beutler Lab
Gene Symbol Glud1
Ensembl Gene ENSMUSG00000021794
Gene Nameglutamate dehydrogenase 1
SynonymsGdh-X, Glud
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4645 (G1)
Quality Score107
Status Validated
Chromosome14
Chromosomal Location34310727-34345265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34311106 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 70 (V70A)
Ref Sequence ENSEMBL: ENSMUSP00000022322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022322] [ENSMUST00000111917] [ENSMUST00000227375] [ENSMUST00000228704]
Predicted Effect probably damaging
Transcript: ENSMUST00000022322
AA Change: V70A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022322
Gene: ENSMUSG00000021794
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
Pfam:ELFV_dehydrog_N 112 242 1.3e-63 PFAM
ELFV_dehydrog 265 554 1.33e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111917
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228132
Predicted Effect probably benign
Transcript: ENSMUST00000228704
Meta Mutation Damage Score 0.8885 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a conditionally allele activated in beta cells exhibit reduced glucose-stimulated insulin secretion and disorganization of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Glud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Glud1 APN 14 34336130 missense probably benign
IGL00973:Glud1 APN 14 34319942 missense probably damaging 1.00
IGL01896:Glud1 APN 14 34319905 missense probably benign 0.00
IGL02442:Glud1 APN 14 34335438 nonsense probably null
IGL03242:Glud1 APN 14 34334280 missense probably benign 0.00
PIT4283001:Glud1 UTSW 14 34336172 missense probably damaging 0.97
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0845:Glud1 UTSW 14 34329394 unclassified probably benign
R1765:Glud1 UTSW 14 34325584 splice site probably benign
R3870:Glud1 UTSW 14 34325580 splice site probably benign
R4773:Glud1 UTSW 14 34321825 critical splice donor site probably null
R4883:Glud1 UTSW 14 34335390 missense possibly damaging 0.56
R5912:Glud1 UTSW 14 34311343 critical splice donor site probably null
R6356:Glud1 UTSW 14 34311216 missense probably benign
R6443:Glud1 UTSW 14 34339927 missense probably benign 0.02
R7658:Glud1 UTSW 14 34311157 missense probably benign 0.25
R7806:Glud1 UTSW 14 34343649 missense probably damaging 1.00
R7817:Glud1 UTSW 14 34329287 critical splice acceptor site probably null
R7862:Glud1 UTSW 14 34325522 missense possibly damaging 0.74
R7945:Glud1 UTSW 14 34325522 missense possibly damaging 0.74
X0013:Glud1 UTSW 14 34338823 missense probably damaging 1.00
Z1177:Glud1 UTSW 14 34310869 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCCGGTCTTTACAGCTC -3'
(R):5'- TCAGTATCCTCTAAGGCTGCCAC -3'

Sequencing Primer
(F):5'- CCATGTACCGCCGTCTG -3'
(R):5'- TTCGATGACCTCCCAGGAG -3'
Posted On2015-10-08