Incidental Mutation 'R4645:Lztr1'
ID350190
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 17524091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000100125] [ENSMUST00000115681] [ENSMUST00000142259] [ENSMUST00000231288] [ENSMUST00000231292] [ENSMUST00000231307] [ENSMUST00000231424] [ENSMUST00000231548] [ENSMUST00000231994] [ENSMUST00000232041] [ENSMUST00000232114] [ENSMUST00000232372]
Predicted Effect probably benign
Transcript: ENSMUST00000023444
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100125
SMART Domains Protein: ENSMUSP00000097701
Gene: ENSMUSG00000022760

DomainStartEndE-ValueType
THAP 3 99 5e-20 SMART
DM3 25 98 4.22e-20 SMART
low complexity region 118 130 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
coiled coil region 239 296 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142222
Predicted Effect
SMART Domains Protein: ENSMUSP00000118569
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
BTB 103 234 4.16e-4 SMART
BTB 327 460 1.7e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231230
Predicted Effect probably benign
Transcript: ENSMUST00000231288
Predicted Effect probably benign
Transcript: ENSMUST00000231292
Predicted Effect probably benign
Transcript: ENSMUST00000231307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231326
Predicted Effect probably benign
Transcript: ENSMUST00000231424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231446
Predicted Effect probably benign
Transcript: ENSMUST00000231548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231746
Predicted Effect probably benign
Transcript: ENSMUST00000231994
Predicted Effect probably benign
Transcript: ENSMUST00000232041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232046
Predicted Effect probably benign
Transcript: ENSMUST00000232114
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 unclassified probably null
IGL01512:Lztr1 APN 16 17522391 unclassified probably null
IGL01514:Lztr1 APN 16 17522391 unclassified probably null
IGL01516:Lztr1 APN 16 17522391 unclassified probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17524237 unclassified probably benign
R0717:Lztr1 UTSW 16 17516048 unclassified probably null
R1511:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17509061 missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R5624:Lztr1 UTSW 16 17512129 splice site probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17524132 missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R8027:Lztr1 UTSW 16 17512112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTCCAGGTGAACAGAAAG -3'
(R):5'- TGGCCTCAAAGTAGCTGCAAG -3'

Sequencing Primer
(F):5'- GACTGAGGGAAGGAATGACTGGC -3'
(R):5'- GATCCCAGCTCTCAGGAGAAG -3'
Posted On2015-10-08