Incidental Mutation 'R4645:Ccdc14'
ID350192
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Namecoiled-coil domain containing 14
Synonyms
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34690616-34725202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34721740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 536 (L536S)
Ref Sequence ENSEMBL: ENSMUSP00000156124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
Predicted Effect probably damaging
Transcript: ENSMUST00000023532
AA Change: L584S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: L584S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231364
Predicted Effect probably damaging
Transcript: ENSMUST00000231609
AA Change: L536S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3833 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2337:Ccdc14 UTSW 16 34705018 missense probably benign 0.04
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5319:Ccdc14 UTSW 16 34723172 missense probably damaging 0.99
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R5945:Ccdc14 UTSW 16 34723588 missense probably damaging 1.00
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6662:Ccdc14 UTSW 16 34690794 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAAGAGCCAGGAGTTAC -3'
(R):5'- TGTTAAAGGTCGGGCTTACC -3'

Sequencing Primer
(F):5'- CTGAAGAGCCAGGAGTTACTACAG -3'
(R):5'- CTTACCCAAGGGAAGTAAGGCTAC -3'
Posted On2015-10-08