Mutagenetix > Incidental Mutation

Incidental Mutation 'R4645:Adgrf5'

350194

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

MMRRC Submission

041906-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4645 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43437525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 29 (E29G)

Ref Sequence

ENSEMBL: ENSMUSP00000153304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225004] [ENSMUST00000225962] [ENSMUST00000226087]

AlphaFold

G5E8Q8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113599
AA Change: E415G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: E415G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225004
AA Change: E29G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225962
AA Change: E170G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226087
AA Change: E415G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.1205

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	T	C	17: 46,324,774	E101G	probably damaging	Het
Agfg2	T	A	5: 137,684,592		probably benign	Het
Ap4b1	A	G	3: 103,821,449	S468G	probably benign	Het
AY702103	G	T	17: 50,239,913		noncoding transcript	Het
Ccdc14	T	C	16: 34,721,740	L536S	probably damaging	Het
Ccr9	G	T	9: 123,779,593	M101I	probably benign	Het
Celsr1	A	T	15: 85,916,756	V2496E	probably benign	Het
Celsr2	C	A	3: 108,395,969	G2486V	probably damaging	Het
Cntnap3	A	G	13: 64,778,788		probably null	Het
Erlin1	T	C	19: 44,069,320	Y22C	probably damaging	Het
Fam135b	T	C	15: 71,462,340	T1002A	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Glud1	T	C	14: 34,311,106	V70A	probably damaging	Het
Hdlbp	A	G	1: 93,422,120		probably benign	Het
Immt	T	C	6: 71,856,939	L184P	probably damaging	Het
Iqsec1	T	G	6: 90,668,013	K983T	probably damaging	Het
Klhl6	A	T	16: 19,947,147	N568K	probably damaging	Het
Lbhd1	T	G	19: 8,884,088		probably benign	Het
Lrit2	C	T	14: 37,072,475	R499C	probably benign	Het
Lrp6	T	C	6: 134,484,250	D748G	probably damaging	Het
Lrriq4	A	G	3: 30,650,743	K292E	probably benign	Het
Ly96	G	T	1: 16,691,716	E49*	probably null	Het
Lztr1	C	T	16: 17,524,091		probably benign	Het
Mmp12	A	G	9: 7,347,515	M31V	probably benign	Het
Mok	A	T	12: 110,808,439		probably benign	Het
Mpi	T	C	9: 57,550,757	H54R	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Olfr1188	T	C	2: 88,560,378	I292T	probably damaging	Het
Pomt1	G	T	2: 32,242,876		probably benign	Het
Ptpn20	G	A	14: 33,631,212	V303I	probably benign	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
Shank2	A	G	7: 144,410,422	K799R	possibly damaging	Het
Sim1	A	T	10: 50,983,997	T652S	probably benign	Het
Slc8a2	C	T	7: 16,134,239	T132I	probably damaging	Het
Spaca6	A	T	17: 17,836,045		probably benign	Het
Sympk	G	T	7: 19,043,460	R545L	possibly damaging	Het
Tenm4	G	T	7: 96,895,742	G2322W	probably damaging	Het
Thap1	A	G	8: 26,162,569	T135A	probably damaging	Het
Traf3	T	C	12: 111,261,966	V537A	probably damaging	Het
Ttn	T	C	2: 76,748,336	D24071G	probably damaging	Het
Tysnd1	G	T	10: 61,696,183	V205L	probably benign	Het
Unc79	T	C	12: 103,112,822	S1749P	probably benign	Het
Vmn2r50	T	A	7: 10,037,235	*846C	probably null	Het
Vmn2r74	C	T	7: 85,957,109	S343N	probably benign	Het
Zfyve28	T	G	5: 34,222,443		probably benign	Het
Zmym2	T	C	14: 56,928,307	S696P	probably damaging	Het
Zscan4e	T	C	7: 11,307,075	Y290C	possibly damaging	Het
Zswim2	G	T	2: 83,915,547	H516N	probably benign	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
Heaped	UTSW	17	43447036	missense	possibly damaging	0.93
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
noel	UTSW	17	43430612	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4616:Adgrf5	UTSW	17	43452440	missense	probably benign	0.38
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R5856:Adgrf5	UTSW	17	43446120	missense	probably benign	0.09
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6602:Adgrf5	UTSW	17	43450304	missense	probably benign	0.32
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7717:Adgrf5	UTSW	17	43450753	missense	probably damaging	1.00
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7950:Adgrf5	UTSW	17	43451157	missense	probably damaging	0.99
R7988:Adgrf5	UTSW	17	43439813	intron	probably benign
R8188:Adgrf5	UTSW	17	43430612	missense	probably damaging	1.00
R8219:Adgrf5	UTSW	17	43449859	missense	probably benign	0.13
R8284:Adgrf5	UTSW	17	43455270	missense	unknown
R8460:Adgrf5	UTSW	17	43439808	intron	probably benign
R8504:Adgrf5	UTSW	17	43446949	missense	probably benign	0.01
R8751:Adgrf5	UTSW	17	43437683	missense	possibly damaging	0.80
R8852:Adgrf5	UTSW	17	43453098	missense	possibly damaging	0.82
R9196:Adgrf5	UTSW	17	43445104	missense	possibly damaging	0.94
R9418:Adgrf5	UTSW	17	43426973	missense	probably benign	0.00
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00
Z1191:Adgrf5	UTSW	17	43445035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CTAAGAGGGTAGATACCTGCCAAG -3'
(R):5'- ATTCCAATCGACTGGCAAGTATAAC -3'

Sequencing Primer
(F):5'- TAGATACCTGCCAAGTTCTAGGG -3'
(R):5'- CGTCTGTCTAAAGAGTCTATGGCAAG -3'

Posted On

2015-10-08