Incidental Mutation 'R4645:Abcc10'
ID350195
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46324774 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000132561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably damaging
Transcript: ENSMUST00000047970
AA Change: E101G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: E101G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095261
AA Change: E60G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: E60G

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165733
Predicted Effect probably damaging
Transcript: ENSMUST00000167360
AA Change: E101G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: E101G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168490
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170168
Predicted Effect probably damaging
Transcript: ENSMUST00000171584
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842
AA Change: E101G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 unclassified probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
decrepit UTSW 17 46324391 missense probably damaging 1.00
shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTACCTCGCTGGCAATG -3'
(R):5'- GCCATGTGCAGACCAGAAAG -3'

Sequencing Primer
(F):5'- TGCCACAGCAGAGTTAGTAC -3'
(R):5'- ATGAGTCACCATGATCTGCG -3'
Posted On2015-10-08