Incidental Mutation 'R4645:Erlin1'
ID350198
Institutional Source Beutler Lab
Gene Symbol Erlin1
Ensembl Gene ENSMUSG00000025198
Gene NameER lipid raft associated 1
Synonyms2810439N09Rik, Spfh1, Keo4
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44034944-44069785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44069320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 22 (Y22C)
Ref Sequence ENSEMBL: ENSMUSP00000131740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000071698] [ENSMUST00000112028] [ENSMUST00000119591] [ENSMUST00000169092] [ENSMUST00000170801] [ENSMUST00000171952] [ENSMUST00000172041]
Predicted Effect probably benign
Transcript: ENSMUST00000026217
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000071698
AA Change: Y22C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071618
Gene: ENSMUSG00000025198
AA Change: Y22C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112028
AA Change: Y22C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107659
Gene: ENSMUSG00000025198
AA Change: Y22C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119591
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168602
Predicted Effect probably damaging
Transcript: ENSMUST00000169092
AA Change: Y22C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170577
Predicted Effect possibly damaging
Transcript: ENSMUST00000170801
AA Change: Y22C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129684
Gene: ENSMUSG00000025198
AA Change: Y22C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171952
AA Change: Y22C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127971
Gene: ENSMUSG00000025198
AA Change: Y22C

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Blast:PHB 24 66 3e-24 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172041
AA Change: Y22C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131012
Gene: ENSMUSG00000025198
AA Change: Y22C

DomainStartEndE-ValueType
PHB 23 158 8.76e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172262
SMART Domains Protein: ENSMUSP00000126271
Gene: ENSMUSG00000025198

DomainStartEndE-ValueType
Blast:PHB 14 59 4e-16 BLAST
Meta Mutation Damage Score 0.2446 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Erlin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Erlin1 APN 19 44069319 nonsense probably null
IGL00551:Erlin1 APN 19 44059146 missense probably damaging 1.00
IGL01975:Erlin1 APN 19 44036931 missense probably damaging 1.00
IGL02171:Erlin1 APN 19 44049116 splice site probably benign
IGL02525:Erlin1 APN 19 44039195 missense probably benign 0.04
IGL02669:Erlin1 APN 19 44039219 missense probably damaging 1.00
IGL02939:Erlin1 APN 19 44063052 missense probably damaging 1.00
R1598:Erlin1 UTSW 19 44047673 missense probably damaging 1.00
R1911:Erlin1 UTSW 19 44049122 missense probably damaging 0.99
R1914:Erlin1 UTSW 19 44059065 missense probably damaging 1.00
R1915:Erlin1 UTSW 19 44059065 missense probably damaging 1.00
R4153:Erlin1 UTSW 19 44067617 missense probably benign 0.11
R4584:Erlin1 UTSW 19 44069319 nonsense probably null
R4607:Erlin1 UTSW 19 44063035 missense probably damaging 1.00
R4633:Erlin1 UTSW 19 44040765 missense probably damaging 0.99
R4652:Erlin1 UTSW 19 44040792 nonsense probably null
R6550:Erlin1 UTSW 19 44037163 splice site probably null
R7320:Erlin1 UTSW 19 44059065 missense probably damaging 1.00
R8062:Erlin1 UTSW 19 44056159 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGCTGGGATGAAACCACTTCC -3'
(R):5'- GAAGAGGTGTCACGACGTAC -3'

Sequencing Primer
(F):5'- GGATGAAACCACTTCCCAGGC -3'
(R):5'- TGTCACGACGTACGCCGAG -3'
Posted On2015-10-08