Mutagenetix > Incidental Mutation

Incidental Mutation 'R0267:Espl1'

35020

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

038493-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0267 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102313017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 953 (V953A)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064924
AA Change: V953A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V953A

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229050
AA Change: V953A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.6%
3x: 97.7%
10x: 96.2%
20x: 94.0%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,046,105	F1721S	probably damaging	Het
Adgrb1	G	A	15: 74,529,389	R78H	probably damaging	Het
Adgrd1	G	A	5: 129,139,594	A342T	probably benign	Het
Adrb1	A	T	19: 56,723,491	K374*	probably null	Het
Aldh18a1	C	A	19: 40,573,789	V264F	probably benign	Het
Aldh1l2	C	T	10: 83,522,687		probably benign	Het
Alox15	T	A	11: 70,346,153	H393L	probably damaging	Het
Aox2	A	G	1: 58,339,446		probably benign	Het
Appbp2	T	C	11: 85,201,462	Y297C	probably damaging	Het
Atxn2l	T	G	7: 126,493,207	Q950P	probably damaging	Het
Bicd1	A	T	6: 149,517,042	D737V	probably damaging	Het
C9	T	C	15: 6,467,458	I212T	probably benign	Het
Ccdc63	A	T	5: 122,117,044		probably benign	Het
Chst1	C	A	2: 92,613,606	P141Q	probably damaging	Het
Cped1	T	A	6: 22,119,476	F311L	probably damaging	Het
D6Wsu163e	T	A	6: 126,946,491	H113Q	probably benign	Het
Dcn	A	T	10: 97,506,483		probably benign	Het
Dmbx1	C	T	4: 115,918,112	A324T	probably benign	Het
Dock10	G	T	1: 80,512,454	Q1618K	probably damaging	Het
Dpyd	A	G	3: 118,917,272	E443G	probably benign	Het
Exosc10	T	C	4: 148,562,756	L174P	probably damaging	Het
Foxg1	A	G	12: 49,385,582	Y366C	probably damaging	Het
Fxyd3	T	C	7: 31,070,734		probably benign	Het
Gbp2	T	C	3: 142,630,106	V189A	probably benign	Het
Gins4	T	C	8: 23,229,410		probably benign	Het
Gm12789	A	G	4: 101,988,122	T3A	probably benign	Het
Gnb1l	T	C	16: 18,548,089		probably benign	Het
Gtpbp3	T	C	8: 71,491,497	L295S	probably damaging	Het
Hrh4	C	A	18: 13,022,398	Y331*	probably null	Het
Hsd11b1	A	T	1: 193,241,397	Y52N	probably damaging	Het
Jam3	A	G	9: 27,106,405	I29T	probably benign	Het
Kctd16	T	A	18: 40,530,877	I353N	probably benign	Het
Lama4	G	T	10: 39,028,639	G246C	probably damaging	Het
Lhx3	T	A	2: 26,203,028	M137L	probably benign	Het
Morc2a	T	C	11: 3,678,567	I340T	probably benign	Het
Myo7a	A	C	7: 98,054,624	I1969S	probably benign	Het
Olfr1471	T	A	19: 13,445,428	C139S	probably damaging	Het
Olfr304	T	C	7: 86,386,267	E131G	possibly damaging	Het
Olfr429	A	G	1: 174,089,166	N42S	probably damaging	Het
Pclo	T	C	5: 14,681,180	L3232P	unknown	Het
Polr1a	T	G	6: 71,974,139	I1407M	probably damaging	Het
Ppip5k2	A	G	1: 97,728,997	V817A	probably damaging	Het
Rbfox3	T	C	11: 118,495,240	T280A	probably benign	Het
Rfx3	T	C	19: 27,793,788	D521G	probably benign	Het
Scn5a	C	T	9: 119,543,135	V223I	probably damaging	Het
Sgsm3	T	G	15: 81,006,602	M119R	probably damaging	Het
Slc6a7	T	A	18: 60,996,711	M608L	probably benign	Het
Slit2	A	G	5: 48,182,331		probably benign	Het
Steap2	T	A	5: 5,673,561	I440F	probably benign	Het
Syn2	T	G	6: 115,254,150		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tfb2m	G	A	1: 179,533,638	H262Y	probably benign	Het
Trmt1l	A	G	1: 151,457,675		probably benign	Het
Trpm6	C	A	19: 18,823,378	P819T	probably benign	Het
Ttn	G	A	2: 76,743,689	A25620V	probably damaging	Het
Ubn2	T	C	6: 38,482,618		probably null	Het
Vars	T	C	17: 35,011,596		probably benign	Het
Vip	A	T	10: 5,644,004	D119V	possibly damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps33b	T	C	7: 80,286,054	I405T	possibly damaging	Het
Zbtb21	T	A	16: 97,952,100	S356C	probably damaging	Het
Zdhhc6	A	T	19: 55,308,930	S237T	probably benign	Het
Zfp142	G	A	1: 74,576,064	A427V	probably benign	Het
Zfp692	T	A	11: 58,314,314	V463E	possibly damaging	Het
Zmynd8	A	T	2: 165,828,402	I384N	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCTCCCTGTAATAATCCCTTGG -3'
(R):5'- TCTCACCTGCGGTGAATGAAAGAC -3'

Sequencing Primer
(F):5'- AGCTCTGTGTTCAATTAGTTCTGTC -3'
(R):5'- ACAGACATCAATGTGGAGCC -3'

Posted On

2013-05-09