Incidental Mutation 'R4646:Acadl'
ID 350202
Institutional Source Beutler Lab
Gene Symbol Acadl
Ensembl Gene ENSMUSG00000026003
Gene Name acyl-Coenzyme A dehydrogenase, long-chain
Synonyms C79855, LCAD
MMRRC Submission 041907-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4646 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66869998-66902436 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66870602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 428 (S428R)
Ref Sequence ENSEMBL: ENSMUSP00000027153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027153]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027153
AA Change: S428R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027153
Gene: ENSMUSG00000026003
AA Change: S428R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 54 165 1.3e-33 PFAM
Pfam:Acyl-CoA_dh_M 169 266 9.2e-29 PFAM
Pfam:Acyl-CoA_dh_1 278 427 5.1e-44 PFAM
Pfam:Acyl-CoA_dh_2 293 416 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C12- and C16-acylCoA. In mice, deficiency of this gene can cause sudden death, cardiomyopathy as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutation of this gene results in reduced litter size, sudden death between 2-14 weeks of age, reduced serum glucose levels, lipid accumulation in the liver and heart, and cardiomyopathy. Heterozygous mutant animals exhibit reduced litter size. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
Adamts10 A G 17: 33,764,529 (GRCm39) D683G probably damaging Het
Angptl4 G A 17: 34,000,273 (GRCm39) P32S probably benign Het
Apob A G 12: 8,062,759 (GRCm39) N134S probably benign Het
Atr G A 9: 95,753,250 (GRCm39) probably null Het
B4galnt1 G A 10: 127,003,705 (GRCm39) V223M probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
C2cd3 A C 7: 100,021,657 (GRCm39) probably benign Het
Clca4b A C 3: 144,634,286 (GRCm39) H102Q probably benign Het
Cntrl T C 2: 35,039,473 (GRCm39) I557T probably damaging Het
Col26a1 G A 5: 136,876,404 (GRCm39) S72F probably damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Csmd1 T C 8: 15,982,511 (GRCm39) I2719V possibly damaging Het
Cul9 C T 17: 46,849,943 (GRCm39) W502* probably null Het
Dazl A T 17: 50,595,183 (GRCm39) F84I probably damaging Het
Dcaf1 G T 9: 106,724,006 (GRCm39) R478L probably benign Het
Dock5 T G 14: 68,080,228 (GRCm39) I198L probably benign Het
Dock9 A T 14: 121,823,658 (GRCm39) L1428H probably damaging Het
Dync1li1 T A 9: 114,538,237 (GRCm39) V198E probably damaging Het
Egf A T 3: 129,513,925 (GRCm39) C429S probably damaging Het
Ehmt1 T C 2: 24,781,696 (GRCm39) E7G probably null Het
Ercc4 G T 16: 12,965,438 (GRCm39) R690L probably damaging Het
Erich5 T C 15: 34,471,112 (GRCm39) C114R possibly damaging Het
Etv1 T C 12: 38,915,685 (GRCm39) S428P possibly damaging Het
Fbxo31 G T 8: 122,286,755 (GRCm39) F174L probably benign Het
Fbxo33 T A 12: 59,251,217 (GRCm39) I433L probably benign Het
Fez2 A T 17: 78,720,357 (GRCm39) V99E probably damaging Het
Gabarapl2 A C 8: 112,669,185 (GRCm39) K48Q probably damaging Het
Gfi1b T A 2: 28,500,149 (GRCm39) H294L probably damaging Het
Gk2 A G 5: 97,604,056 (GRCm39) S261P probably damaging Het
Gpr158 T C 2: 21,831,864 (GRCm39) I988T probably benign Het
Grk3 G C 5: 113,077,586 (GRCm39) H394D probably benign Het
Grm6 A G 11: 50,748,033 (GRCm39) E381G probably benign Het
Gtf3c1 A T 7: 125,258,266 (GRCm39) M1268K possibly damaging Het
Hikeshi A T 7: 89,572,854 (GRCm39) I113N probably damaging Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Hunk C A 16: 90,272,791 (GRCm39) T365K probably damaging Het
Ints15 A T 5: 143,293,740 (GRCm39) W246R probably damaging Het
Kdm5a T G 6: 120,351,938 (GRCm39) V176G possibly damaging Het
Kif2a T A 13: 107,098,693 (GRCm39) E691V probably damaging Het
Ly6e T C 15: 74,830,510 (GRCm39) probably null Het
Map1b G T 13: 99,568,977 (GRCm39) P1248Q unknown Het
Mettl25 A G 10: 105,662,416 (GRCm39) S185P probably damaging Het
Mfap3l T A 8: 61,124,184 (GRCm39) V142D probably damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mkx G A 18: 6,992,040 (GRCm39) T280I probably benign Het
Msi1 A T 5: 115,589,514 (GRCm39) probably null Het
Mtcl2 T C 2: 156,862,426 (GRCm39) E1501G probably damaging Het
Muc5b A G 7: 141,416,377 (GRCm39) M3108V probably benign Het
Mybl1 A G 1: 9,742,511 (GRCm39) S625P probably damaging Het
Myo7b C A 18: 32,127,422 (GRCm39) V627F probably benign Het
Ndst3 A T 3: 123,465,684 (GRCm39) I96N probably damaging Het
Nrp1 A T 8: 129,184,425 (GRCm39) T357S probably benign Het
Obscn G T 11: 59,015,396 (GRCm39) Y1050* probably null Het
Or2ak7 A G 11: 58,575,556 (GRCm39) N286D probably damaging Het
Or2d4 A T 7: 106,543,547 (GRCm39) N220K probably benign Het
Or2y1c A C 11: 49,361,451 (GRCm39) I158L probably benign Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5d47 A T 2: 87,804,142 (GRCm39) I289K probably benign Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Pick1 A T 15: 79,133,137 (GRCm39) D399V probably benign Het
Pik3c2g T A 6: 139,665,744 (GRCm39) S22T probably benign Het
Pnpla2 A G 7: 141,038,574 (GRCm39) E276G possibly damaging Het
Pomk A T 8: 26,473,633 (GRCm39) S107T probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rimbp3 A G 16: 17,030,962 (GRCm39) D1462G probably damaging Het
Rnf112 T A 11: 61,342,936 (GRCm39) E230V probably damaging Het
Rock1 T C 18: 10,112,391 (GRCm39) T455A probably benign Het
Rtp4 A T 16: 23,428,790 (GRCm39) M18L probably benign Het
Scaf11 A T 15: 96,317,981 (GRCm39) probably null Het
Schip1 T C 3: 67,972,297 (GRCm39) V8A probably benign Het
Sec31b T C 19: 44,515,060 (GRCm39) H351R probably benign Het
Sh3bp5l A G 11: 58,237,177 (GRCm39) D378G probably benign Het
Sowahb T C 5: 93,190,715 (GRCm39) D668G probably damaging Het
Spam1 A G 6: 24,800,586 (GRCm39) T442A probably benign Het
Syt14 T A 1: 192,615,633 (GRCm39) Y451F probably damaging Het
Tafa5 T G 15: 87,604,783 (GRCm39) S115A probably damaging Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Thbs1 G A 2: 117,948,810 (GRCm39) A489T probably benign Het
Tnfaip1 C T 11: 78,420,008 (GRCm39) R88Q probably damaging Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trim55 T C 3: 19,725,286 (GRCm39) F268L probably benign Het
Trmt112 T A 19: 6,887,816 (GRCm39) V55E possibly damaging Het
Tube1 A G 10: 39,018,363 (GRCm39) M147V possibly damaging Het
Ubn1 A G 16: 4,895,851 (GRCm39) T966A probably damaging Het
Unc80 A G 1: 66,708,394 (GRCm39) I2651V probably benign Het
Vmn1r172 G A 7: 23,359,919 (GRCm39) R268H probably benign Het
Vmn1r231 T A 17: 21,110,571 (GRCm39) I115F probably damaging Het
Vmn1r237 A G 17: 21,534,400 (GRCm39) K41R probably benign Het
Vmn2r58 A T 7: 41,509,935 (GRCm39) N547K probably damaging Het
Vmn2r74 T C 7: 85,606,782 (GRCm39) D188G probably benign Het
Vwa5b2 A G 16: 20,415,079 (GRCm39) K367R probably damaging Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Wbp11 T A 6: 136,798,189 (GRCm39) Y236F probably benign Het
Wbp4 T A 14: 79,709,801 (GRCm39) I145F possibly damaging Het
Wwc2 C A 8: 48,373,636 (GRCm39) D77Y probably damaging Het
Zpld2 G A 4: 133,929,459 (GRCm39) A282V probably benign Het
Other mutations in Acadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Acadl APN 1 66,880,864 (GRCm39) missense probably damaging 0.97
IGL01983:Acadl APN 1 66,880,783 (GRCm39) nonsense probably null
IGL02550:Acadl APN 1 66,884,325 (GRCm39) critical splice donor site probably null
IGL02934:Acadl APN 1 66,876,134 (GRCm39) missense probably benign 0.33
IGL03002:Acadl APN 1 66,876,128 (GRCm39) missense probably benign 0.01
B6584:Acadl UTSW 1 66,887,632 (GRCm39) splice site probably benign
PIT4377001:Acadl UTSW 1 66,877,564 (GRCm39) missense probably damaging 1.00
R0426:Acadl UTSW 1 66,880,805 (GRCm39) missense probably damaging 0.99
R0639:Acadl UTSW 1 66,896,567 (GRCm39) missense probably benign
R1264:Acadl UTSW 1 66,896,712 (GRCm39) missense probably benign 0.00
R1589:Acadl UTSW 1 66,892,382 (GRCm39) missense probably benign 0.04
R2066:Acadl UTSW 1 66,880,905 (GRCm39) splice site probably null
R3735:Acadl UTSW 1 66,892,448 (GRCm39) missense probably benign 0.41
R5690:Acadl UTSW 1 66,892,445 (GRCm39) missense probably damaging 1.00
R6185:Acadl UTSW 1 66,877,522 (GRCm39) missense possibly damaging 0.72
R7686:Acadl UTSW 1 66,887,557 (GRCm39) critical splice donor site probably null
R7699:Acadl UTSW 1 66,877,522 (GRCm39) missense possibly damaging 0.72
R7700:Acadl UTSW 1 66,877,522 (GRCm39) missense possibly damaging 0.72
R7858:Acadl UTSW 1 66,877,483 (GRCm39) missense probably benign 0.11
R8052:Acadl UTSW 1 66,892,337 (GRCm39) missense probably benign 0.35
R8389:Acadl UTSW 1 66,893,906 (GRCm39) missense probably damaging 1.00
R9381:Acadl UTSW 1 66,893,805 (GRCm39) missense probably benign
R9457:Acadl UTSW 1 66,892,400 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GACAAAACTTTAGACTCTTGGGCTC -3'
(R):5'- GGCTCCTATTGCTCAGAGTTCC -3'

Sequencing Primer
(F):5'- GACTCTTGGGCTCAAAAATTTCTC -3'
(R):5'- TGCTCAGAGTTCCTTAACCAATAG -3'
Posted On 2015-10-08