Incidental Mutation 'R4646:Egf'
ID350221
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Nameepidermal growth factor
Synonyms
MMRRC Submission 041907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4646 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129677565-129755316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129720276 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 429 (C429S)
Ref Sequence ENSEMBL: ENSMUSP00000029653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653] [ENSMUST00000197079] [ENSMUST00000197713] [ENSMUST00000199615]
PDB Structure ROLE OF THE 6-20 DISULFIDE BRIDGE IN THE STRUCTURE AND ACTIVITY OF EPIDERMAL GROWTH FACTOR, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
SOLUTION STRUCTURE THE MEGF/TGFALPHA44-50 CHIMERIC GROWTH FACTOR [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029653
AA Change: C429S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: C429S

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197079
SMART Domains Protein: ENSMUSP00000143075
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF_like 418 458 1.7e-6 SMART
EGF 480 518 1.3e-6 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197713
SMART Domains Protein: ENSMUSP00000143108
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199615
SMART Domains Protein: ENSMUSP00000142497
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF 439 477 1.3e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 538 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
Acadl A T 1: 66,831,443 S428R probably benign Het
Adamts10 A G 17: 33,545,555 D683G probably damaging Het
Angptl4 G A 17: 33,781,299 P32S probably benign Het
Apob A G 12: 8,012,759 N134S probably benign Het
Atr G A 9: 95,871,197 probably null Het
B4galnt1 G A 10: 127,167,836 V223M probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C2cd3 A C 7: 100,372,450 probably benign Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cntrl T C 2: 35,149,461 I557T probably damaging Het
Col26a1 G A 5: 136,847,550 S72F probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Csmd1 T C 8: 15,932,511 I2719V possibly damaging Het
Cul9 C T 17: 46,539,017 W502* probably null Het
Dazl A T 17: 50,288,155 F84I probably damaging Het
Dcaf1 G T 9: 106,846,807 R478L probably benign Het
Dock5 T G 14: 67,842,779 I198L probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dync1li1 T A 9: 114,709,169 V198E probably damaging Het
E130309D02Rik A T 5: 143,307,985 W246R probably damaging Het
Ehmt1 T C 2: 24,891,684 E7G probably null Het
Ercc4 G T 16: 13,147,574 R690L probably damaging Het
Erich5 T C 15: 34,470,966 C114R possibly damaging Het
Etv1 T C 12: 38,865,686 S428P possibly damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fbxo31 G T 8: 121,560,016 F174L probably benign Het
Fbxo33 T A 12: 59,204,431 I433L probably benign Het
Fez2 A T 17: 78,412,928 V99E probably damaging Het
Gabarapl2 A C 8: 111,942,553 K48Q probably damaging Het
Gfi1b T A 2: 28,610,137 H294L probably damaging Het
Gk2 A G 5: 97,456,197 S261P probably damaging Het
Gm7534 G A 4: 134,202,148 A282V probably benign Het
Gpr158 T C 2: 21,827,053 I988T probably benign Het
Grk3 G C 5: 112,929,720 H394D probably benign Het
Grm6 A G 11: 50,857,206 E381G probably benign Het
Gtf3c1 A T 7: 125,659,094 M1268K possibly damaging Het
Hikeshi A T 7: 89,923,646 I113N probably damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Kdm5a T G 6: 120,374,977 V176G possibly damaging Het
Kif2a T A 13: 106,962,185 E691V probably damaging Het
Ly6e T C 15: 74,958,661 probably null Het
Map1b G T 13: 99,432,469 P1248Q unknown Het
Mettl25 A G 10: 105,826,555 S185P probably damaging Het
Mfap3l T A 8: 60,671,150 V142D probably damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mkx G A 18: 6,992,040 T280I probably benign Het
Msi1 A T 5: 115,451,455 probably null Het
Muc5b A G 7: 141,862,640 M3108V probably benign Het
Mybl1 A G 1: 9,672,286 S625P probably damaging Het
Myo7b C A 18: 31,994,369 V627F probably benign Het
Ndst3 A T 3: 123,672,035 I96N probably damaging Het
Nrp1 A T 8: 128,457,944 T357S probably benign Het
Obscn G T 11: 59,124,570 Y1050* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1386 A C 11: 49,470,624 I158L probably benign Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr320 A G 11: 58,684,730 N286D probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Olfr74 A T 2: 87,973,798 I289K probably benign Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Pick1 A T 15: 79,248,937 D399V probably benign Het
Pik3c2g T A 6: 139,720,018 S22T probably benign Het
Pnpla2 A G 7: 141,458,661 E276G possibly damaging Het
Pomk A T 8: 25,983,605 S107T probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rimbp3 A G 16: 17,213,098 D1462G probably damaging Het
Rnf112 T A 11: 61,452,110 E230V probably damaging Het
Rock1 T C 18: 10,112,391 T455A probably benign Het
Rtp4 A T 16: 23,610,040 M18L probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Schip1 T C 3: 68,064,964 V8A probably benign Het
Sec31b T C 19: 44,526,621 H351R probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Soga1 T C 2: 157,020,506 E1501G probably damaging Het
Sowahb T C 5: 93,042,856 D668G probably damaging Het
Spam1 A G 6: 24,800,587 T442A probably benign Het
Syt14 T A 1: 192,933,325 Y451F probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Thbs1 G A 2: 118,118,329 A489T probably benign Het
Tnfaip1 C T 11: 78,529,182 R88Q probably damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trim55 T C 3: 19,671,122 F268L probably benign Het
Trmt112 T A 19: 6,910,448 V55E possibly damaging Het
Tube1 A G 10: 39,142,367 M147V possibly damaging Het
Ubn1 A G 16: 5,077,987 T966A probably damaging Het
Unc80 A G 1: 66,669,235 I2651V probably benign Het
Vmn1r172 G A 7: 23,660,494 R268H probably benign Het
Vmn1r231 T A 17: 20,890,309 I115F probably damaging Het
Vmn1r237 A G 17: 21,314,138 K41R probably benign Het
Vmn2r58 A T 7: 41,860,511 N547K probably damaging Het
Vmn2r74 T C 7: 85,957,574 D188G probably benign Het
Vwa5b2 A G 16: 20,596,329 K367R probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp11 T A 6: 136,821,191 Y236F probably benign Het
Wbp4 T A 14: 79,472,361 I145F possibly damaging Het
Wwc2 C A 8: 47,920,601 D77Y probably damaging Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129711449 missense probably benign 0.01
IGL00579:Egf APN 3 129697798 missense probably benign 0.36
IGL01307:Egf APN 3 129739993 missense probably damaging 0.99
IGL01314:Egf APN 3 129686260 missense probably benign 0.16
IGL01360:Egf APN 3 129740020 missense probably damaging 1.00
IGL01367:Egf APN 3 129702455 critical splice donor site probably null
IGL01610:Egf APN 3 129706260 splice site probably benign
IGL01721:Egf APN 3 129697722 nonsense probably null
IGL01803:Egf APN 3 129736766 missense probably benign 0.09
IGL01866:Egf APN 3 129735880 missense probably benign 0.03
IGL02001:Egf APN 3 129716768 missense probably damaging 1.00
IGL02141:Egf APN 3 129739982 nonsense probably null
IGL02209:Egf APN 3 129707307 missense possibly damaging 0.93
IGL02347:Egf APN 3 129678377 missense probably benign 0.17
IGL02821:Egf APN 3 129702479 missense probably damaging 1.00
IGL02902:Egf APN 3 129681147 missense probably benign 0.34
IGL03114:Egf APN 3 129736880 missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129702549 missense probably benign 0.00
R0200:Egf UTSW 3 129706233 missense probably benign 0.00
R0200:Egf UTSW 3 129737549 missense probably damaging 1.00
R0463:Egf UTSW 3 129706233 missense probably benign 0.00
R0463:Egf UTSW 3 129737549 missense probably damaging 1.00
R0507:Egf UTSW 3 129681179 missense possibly damaging 0.62
R0801:Egf UTSW 3 129702585 splice site probably benign
R1495:Egf UTSW 3 129713006 missense probably damaging 1.00
R1535:Egf UTSW 3 129690778 missense probably benign 0.00
R1626:Egf UTSW 3 129686215 missense possibly damaging 0.55
R1702:Egf UTSW 3 129690811 missense probably benign 0.17
R1906:Egf UTSW 3 129725224 missense probably benign 0.01
R2184:Egf UTSW 3 129723358 nonsense probably null
R3842:Egf UTSW 3 129697793 nonsense probably null
R3918:Egf UTSW 3 129696860 missense probably null 0.22
R4073:Egf UTSW 3 129735969 missense probably benign 0.01
R4074:Egf UTSW 3 129735969 missense probably benign 0.01
R4075:Egf UTSW 3 129735969 missense probably benign 0.01
R4307:Egf UTSW 3 129719095 missense probably damaging 0.99
R4321:Egf UTSW 3 129706134 missense probably damaging 1.00
R4617:Egf UTSW 3 129690793 missense probably benign 0.02
R4674:Egf UTSW 3 129718040 missense probably damaging 1.00
R4798:Egf UTSW 3 129716678 missense probably damaging 1.00
R4931:Egf UTSW 3 129711468 missense probably damaging 1.00
R4992:Egf UTSW 3 129711530 splice site probably null
R5166:Egf UTSW 3 129735840 missense probably benign
R5179:Egf UTSW 3 129686287 missense probably damaging 0.99
R5230:Egf UTSW 3 129718024 missense possibly damaging 0.95
R6043:Egf UTSW 3 129736785 missense probably benign 0.09
R6119:Egf UTSW 3 129736772 missense probably benign 0.00
R6493:Egf UTSW 3 129719088 start gained probably benign
R6639:Egf UTSW 3 129736832 missense probably benign 0.22
R6936:Egf UTSW 3 129681204 missense possibly damaging 0.95
R7019:Egf UTSW 3 129718064 splice site probably null
R7046:Egf UTSW 3 129754958 missense unknown
R7463:Egf UTSW 3 129740015 missense probably benign 0.39
R7472:Egf UTSW 3 129686263 missense possibly damaging 0.53
R7723:Egf UTSW 3 129706137 missense probably benign 0.00
R7920:Egf UTSW 3 129735840 missense probably benign
R7952:Egf UTSW 3 129739996 missense probably damaging 1.00
R8098:Egf UTSW 3 129690837 missense probably benign 0.09
R8344:Egf UTSW 3 129754943 missense unknown
R8557:Egf UTSW 3 129754951 missense unknown
R8912:Egf UTSW 3 129737515 missense possibly damaging 0.47
X0011:Egf UTSW 3 129711298 missense probably benign 0.19
Z1176:Egf UTSW 3 129697717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCAGGACTAACAATGTC -3'
(R):5'- CTGTGGTATCTCATAAATGTTAGGG -3'

Sequencing Primer
(F):5'- TGTCACAGAACATTCTAGAATCCAC -3'
(R):5'- CCTTTCAGAGTAGCAACTGA -3'
Posted On2015-10-08