Incidental Mutation 'R4646:Pomk'
ID350247
Institutional Source Beutler Lab
Gene Symbol Pomk
Ensembl Gene ENSMUSG00000037251
Gene Nameprotein-O-mannose kinase
SynonymsSgk196, 4930444A02Rik
MMRRC Submission 041907-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R4646 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25980604-25994133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25983605 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 107 (S107T)
Ref Sequence ENSEMBL: ENSMUSP00000053802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061850]
Predicted Effect probably damaging
Transcript: ENSMUST00000061850
AA Change: S107T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053802
Gene: ENSMUSG00000037251
AA Change: S107T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Pkinase 80 207 2e-6 PFAM
Pfam:Pkinase_Tyr 80 215 5.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap insertion show hydrocephaly and cerebellar dysplasia. Mice also show learning defects, impaired motor strength and decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
Acadl A T 1: 66,831,443 S428R probably benign Het
Adamts10 A G 17: 33,545,555 D683G probably damaging Het
Angptl4 G A 17: 33,781,299 P32S probably benign Het
Apob A G 12: 8,012,759 N134S probably benign Het
Atr G A 9: 95,871,197 probably null Het
B4galnt1 G A 10: 127,167,836 V223M probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C2cd3 A C 7: 100,372,450 probably benign Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cntrl T C 2: 35,149,461 I557T probably damaging Het
Col26a1 G A 5: 136,847,550 S72F probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Csmd1 T C 8: 15,932,511 I2719V possibly damaging Het
Cul9 C T 17: 46,539,017 W502* probably null Het
Dazl A T 17: 50,288,155 F84I probably damaging Het
Dcaf1 G T 9: 106,846,807 R478L probably benign Het
Dock5 T G 14: 67,842,779 I198L probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dync1li1 T A 9: 114,709,169 V198E probably damaging Het
E130309D02Rik A T 5: 143,307,985 W246R probably damaging Het
Egf A T 3: 129,720,276 C429S probably damaging Het
Ehmt1 T C 2: 24,891,684 E7G probably null Het
Ercc4 G T 16: 13,147,574 R690L probably damaging Het
Erich5 T C 15: 34,470,966 C114R possibly damaging Het
Etv1 T C 12: 38,865,686 S428P possibly damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fbxo31 G T 8: 121,560,016 F174L probably benign Het
Fbxo33 T A 12: 59,204,431 I433L probably benign Het
Fez2 A T 17: 78,412,928 V99E probably damaging Het
Gabarapl2 A C 8: 111,942,553 K48Q probably damaging Het
Gfi1b T A 2: 28,610,137 H294L probably damaging Het
Gk2 A G 5: 97,456,197 S261P probably damaging Het
Gm7534 G A 4: 134,202,148 A282V probably benign Het
Gpr158 T C 2: 21,827,053 I988T probably benign Het
Grk3 G C 5: 112,929,720 H394D probably benign Het
Grm6 A G 11: 50,857,206 E381G probably benign Het
Gtf3c1 A T 7: 125,659,094 M1268K possibly damaging Het
Hikeshi A T 7: 89,923,646 I113N probably damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Kdm5a T G 6: 120,374,977 V176G possibly damaging Het
Kif2a T A 13: 106,962,185 E691V probably damaging Het
Ly6e T C 15: 74,958,661 probably null Het
Map1b G T 13: 99,432,469 P1248Q unknown Het
Mettl25 A G 10: 105,826,555 S185P probably damaging Het
Mfap3l T A 8: 60,671,150 V142D probably damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mkx G A 18: 6,992,040 T280I probably benign Het
Msi1 A T 5: 115,451,455 probably null Het
Muc5b A G 7: 141,862,640 M3108V probably benign Het
Mybl1 A G 1: 9,672,286 S625P probably damaging Het
Myo7b C A 18: 31,994,369 V627F probably benign Het
Ndst3 A T 3: 123,672,035 I96N probably damaging Het
Nrp1 A T 8: 128,457,944 T357S probably benign Het
Obscn G T 11: 59,124,570 Y1050* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1386 A C 11: 49,470,624 I158L probably benign Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr320 A G 11: 58,684,730 N286D probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Olfr74 A T 2: 87,973,798 I289K probably benign Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Pick1 A T 15: 79,248,937 D399V probably benign Het
Pik3c2g T A 6: 139,720,018 S22T probably benign Het
Pnpla2 A G 7: 141,458,661 E276G possibly damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rimbp3 A G 16: 17,213,098 D1462G probably damaging Het
Rnf112 T A 11: 61,452,110 E230V probably damaging Het
Rock1 T C 18: 10,112,391 T455A probably benign Het
Rtp4 A T 16: 23,610,040 M18L probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Schip1 T C 3: 68,064,964 V8A probably benign Het
Sec31b T C 19: 44,526,621 H351R probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Soga1 T C 2: 157,020,506 E1501G probably damaging Het
Sowahb T C 5: 93,042,856 D668G probably damaging Het
Spam1 A G 6: 24,800,587 T442A probably benign Het
Syt14 T A 1: 192,933,325 Y451F probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Thbs1 G A 2: 118,118,329 A489T probably benign Het
Tnfaip1 C T 11: 78,529,182 R88Q probably damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trim55 T C 3: 19,671,122 F268L probably benign Het
Trmt112 T A 19: 6,910,448 V55E possibly damaging Het
Tube1 A G 10: 39,142,367 M147V possibly damaging Het
Ubn1 A G 16: 5,077,987 T966A probably damaging Het
Unc80 A G 1: 66,669,235 I2651V probably benign Het
Vmn1r172 G A 7: 23,660,494 R268H probably benign Het
Vmn1r231 T A 17: 20,890,309 I115F probably damaging Het
Vmn1r237 A G 17: 21,314,138 K41R probably benign Het
Vmn2r58 A T 7: 41,860,511 N547K probably damaging Het
Vmn2r74 T C 7: 85,957,574 D188G probably benign Het
Vwa5b2 A G 16: 20,596,329 K367R probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp11 T A 6: 136,821,191 Y236F probably benign Het
Wbp4 T A 14: 79,472,361 I145F possibly damaging Het
Wwc2 C A 8: 47,920,601 D77Y probably damaging Het
Other mutations in Pomk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Pomk APN 8 25983596 missense probably benign 0.21
IGL02678:Pomk APN 8 25983107 missense probably damaging 0.97
IGL03090:Pomk APN 8 25983310 missense probably damaging 0.99
R1302:Pomk UTSW 8 25983074 missense probably damaging 1.00
R3105:Pomk UTSW 8 25982914 missense probably damaging 1.00
R5106:Pomk UTSW 8 25986376 missense probably benign 0.00
R5343:Pomk UTSW 8 25983016 missense probably benign 0.09
R5572:Pomk UTSW 8 25983190 missense possibly damaging 0.88
R5953:Pomk UTSW 8 25983048 missense probably damaging 1.00
R6150:Pomk UTSW 8 25983256 missense possibly damaging 0.89
R6295:Pomk UTSW 8 25982927 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGCTGCCAAGTGTTCAC -3'
(R):5'- TGGAAGAGTCTCATCTCCCC -3'

Sequencing Primer
(F):5'- GCCAAGTGTTCACGTCTTGGTAC -3'
(R):5'- GAAGAGTCTCATCTCCCCCTTGAC -3'
Posted On2015-10-08