Incidental Mutation 'R4647:Trmt1l'
ID 350313
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms 1190005F20Rik, Trm1-like
MMRRC Submission 041908-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4647 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 151304293-151333912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 151333632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 712 (V712F)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000065625
AA Change: V712F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: V712F

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
Aatf T C 11: 84,362,023 (GRCm39) D313G possibly damaging Het
Abcb11 T G 2: 69,115,615 (GRCm39) D583A probably damaging Het
Adgrv1 A T 13: 81,676,914 (GRCm39) Y1252* probably null Het
Aim2 T C 1: 173,283,090 (GRCm39) silent Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd27 C T 7: 35,337,659 (GRCm39) P991L probably benign Het
Ap1s3 C T 1: 79,591,920 (GRCm39) probably null Het
Apbb1 A C 7: 105,214,745 (GRCm39) S500A probably benign Het
Arc G A 15: 74,543,374 (GRCm39) A283V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
C1qtnf4 T A 2: 90,719,996 (GRCm39) S90T probably damaging Het
Cachd1 A T 4: 100,810,327 (GRCm39) K310* probably null Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Carmil1 G A 13: 24,321,162 (GRCm39) L278F probably damaging Het
Ccar1 A T 10: 62,583,196 (GRCm39) Y972* probably null Het
Cd163 C T 6: 124,297,580 (GRCm39) P909S probably damaging Het
Cd44 T A 2: 102,668,274 (GRCm39) H268L possibly damaging Het
Cdkl2 A T 5: 92,165,072 (GRCm39) L517Q probably damaging Het
Cep68 G T 11: 20,189,349 (GRCm39) N554K probably benign Het
Ces1d A G 8: 93,893,038 (GRCm39) W515R probably damaging Het
Clca4b A C 3: 144,634,286 (GRCm39) H102Q probably benign Het
Cldn15 T A 5: 137,003,337 (GRCm39) I142N probably damaging Het
Cmklr1 T A 5: 113,752,701 (GRCm39) D100V probably damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
D430041D05Rik G A 2: 104,088,788 (GRCm39) P63S probably damaging Het
Ddx39a A T 8: 84,448,902 (GRCm39) H259L probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dimt1 A T 13: 107,084,163 (GRCm39) D50V probably benign Het
Dock9 A T 14: 121,823,658 (GRCm39) L1428H probably damaging Het
Dpp4 G T 2: 62,164,949 (GRCm39) T700K probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Eea1 A G 10: 95,864,255 (GRCm39) T925A probably benign Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Fam171a1 G A 2: 3,221,328 (GRCm39) E140K probably damaging Het
Fgfr3 C T 5: 33,892,330 (GRCm39) probably benign Het
Gabra6 A G 11: 42,198,199 (GRCm39) I407T probably damaging Het
Gm16223 C A 5: 42,371,954 (GRCm39) L115M unknown Het
Gm4781 G T 10: 100,232,862 (GRCm39) noncoding transcript Het
Gm9772 T A 17: 22,226,013 (GRCm39) I70F possibly damaging Het
Gpr107 T A 2: 31,100,513 (GRCm39) F497Y probably damaging Het
Grm7 T A 6: 110,891,344 (GRCm39) Y192* probably null Het
Gtf2ird2 G A 5: 134,245,034 (GRCm39) A431T probably damaging Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
H2-M11 T A 17: 36,858,883 (GRCm39) V141D probably benign Het
Hmcn1 A G 1: 150,551,262 (GRCm39) probably null Het
Hmcn2 A T 2: 31,289,031 (GRCm39) Q2280L possibly damaging Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Igfbp7 T A 5: 77,499,143 (GRCm39) Q285L possibly damaging Het
Igkv13-85 T A 6: 68,907,720 (GRCm39) probably benign Het
Inpp5e A T 2: 26,297,926 (GRCm39) L225H probably benign Het
Inpp5f T A 7: 128,260,833 (GRCm39) V91E possibly damaging Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Klra5 T A 6: 129,876,339 (GRCm39) D156V probably damaging Het
Kmo C A 1: 175,487,340 (GRCm39) Y430* probably null Het
Lbx2 A G 6: 83,065,027 (GRCm39) D188G probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lrrc45 T A 11: 120,609,947 (GRCm39) S464T probably benign Het
Ltc4s T A 11: 50,128,052 (GRCm39) T61S probably benign Het
Luc7l3 A C 11: 94,200,467 (GRCm39) N50K probably damaging Het
Ly75 G A 2: 60,138,622 (GRCm39) T1415M probably damaging Het
Macf1 T C 4: 123,367,420 (GRCm39) E2447G probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mbtd1 C T 11: 93,815,437 (GRCm39) H342Y probably damaging Het
Mest C T 6: 30,745,109 (GRCm39) R226* probably null Het
Mindy1 A T 3: 95,190,054 (GRCm39) probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mn1 A G 5: 111,567,949 (GRCm39) T640A probably benign Het
Msi2 T C 11: 88,608,864 (GRCm39) H18R possibly damaging Het
Myo18a T A 11: 77,708,776 (GRCm39) V61E probably damaging Het
Myo19 T G 11: 84,785,468 (GRCm39) I237S probably damaging Het
Ncaph2 T A 15: 89,254,635 (GRCm39) L416Q probably damaging Het
Nlrp1a T A 11: 70,987,952 (GRCm39) probably null Het
Or1n1b A G 2: 36,780,663 (GRCm39) F66L probably benign Het
Or2d4 A T 7: 106,543,547 (GRCm39) N220K probably benign Het
Or51a25 A G 7: 102,373,299 (GRCm39) S133P probably damaging Het
Or5b98 A G 19: 12,931,441 (GRCm39) I163V probably benign Het
Or8s10 G T 15: 98,335,457 (GRCm39) V36F probably benign Het
Padi2 T C 4: 140,671,757 (GRCm39) F495S probably damaging Het
Pan3 G T 5: 147,464,013 (GRCm39) D535Y probably damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl1 T A 19: 11,891,798 (GRCm39) D34E probably damaging Het
Pcdha6 A T 18: 37,102,189 (GRCm39) T461S probably damaging Het
Pcnt T C 10: 76,190,047 (GRCm39) S2830G probably benign Het
Pdgfa G A 5: 138,964,939 (GRCm39) T181I probably benign Het
Pds5a C A 5: 65,813,661 (GRCm39) D275Y probably damaging Het
Plod2 T A 9: 92,487,503 (GRCm39) Y607* probably null Het
Pomt2 G T 12: 87,164,857 (GRCm39) T517K possibly damaging Het
Pramel23 T C 4: 143,425,914 (GRCm39) M10V probably benign Het
Prdm1 T C 10: 44,315,686 (GRCm39) T817A probably damaging Het
Prdm2 T C 4: 142,859,525 (GRCm39) D1255G possibly damaging Het
Prex2 T A 1: 11,232,509 (GRCm39) C859S probably damaging Het
Ralgapa2 A T 2: 146,229,549 (GRCm39) M1077K possibly damaging Het
Ralgds T C 2: 28,435,532 (GRCm39) probably null Het
Rasa3 T C 8: 13,638,865 (GRCm39) E314G probably null Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rnf139 A T 15: 58,771,836 (GRCm39) L620F probably benign Het
Rptor T A 11: 119,781,989 (GRCm39) N1105K probably benign Het
Scaf11 A T 15: 96,317,981 (GRCm39) probably null Het
Sectm1b A T 11: 120,946,760 (GRCm39) V45E probably damaging Het
Selenon A G 4: 134,272,968 (GRCm39) W157R probably damaging Het
Sema3b C A 9: 107,476,250 (GRCm39) R657L possibly damaging Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Sh3tc1 C T 5: 35,863,662 (GRCm39) A842T probably damaging Het
Shank2 A G 7: 143,965,566 (GRCm39) E1268G probably damaging Het
Shmt1 G A 11: 60,692,291 (GRCm39) S155F probably damaging Het
Sim2 A G 16: 93,924,385 (GRCm39) E510G possibly damaging Het
Slc25a46 A T 18: 31,733,245 (GRCm39) I168N probably damaging Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Slfn14 G T 11: 83,167,484 (GRCm39) A677E probably benign Het
Slk G T 19: 47,608,713 (GRCm39) Q555H possibly damaging Het
Synj1 A T 16: 90,770,877 (GRCm39) D517E probably damaging Het
Syvn1 G A 19: 6,101,504 (GRCm39) R440Q probably benign Het
Tafa5 T G 15: 87,604,783 (GRCm39) S115A probably damaging Het
Tas2r118 A T 6: 23,969,467 (GRCm39) I198N probably damaging Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Timeless A G 10: 128,075,825 (GRCm39) Y19C possibly damaging Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Tti1 T C 2: 157,848,940 (GRCm39) probably benign Het
Ulk4 T C 9: 120,970,918 (GRCm39) H1018R probably benign Het
Vim A T 2: 13,587,306 (GRCm39) H461L probably benign Het
Vmn2r118 T A 17: 55,917,665 (GRCm39) E282D probably damaging Het
Vmn2r31 T A 7: 7,387,367 (GRCm39) I735F probably damaging Het
Vmn2r88 A G 14: 51,656,250 (GRCm39) M829V probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Wbp2 T A 11: 115,973,207 (GRCm39) M67L probably benign Het
Wdr81 T A 11: 75,336,814 (GRCm39) E1525V probably damaging Het
Xbp1 A G 11: 5,472,006 (GRCm39) D44G probably damaging Het
Zfhx4 T G 3: 5,464,341 (GRCm39) F1500V probably damaging Het
Zfp286 A C 11: 62,674,559 (GRCm39) Y95* probably null Het
Zfp872 A G 9: 22,111,057 (GRCm39) T178A possibly damaging Het
Zkscan5 A G 5: 145,155,640 (GRCm39) H364R possibly damaging Het
Zp3r A T 1: 130,505,697 (GRCm39) Y422N probably damaging Het
Zscan10 C T 17: 23,829,314 (GRCm39) R542C probably benign Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151,318,463 (GRCm39) critical splice donor site probably null
IGL02175:Trmt1l APN 1 151,324,235 (GRCm39) missense probably benign 0.00
IGL02348:Trmt1l APN 1 151,325,757 (GRCm39) missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151,315,282 (GRCm39) missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151,309,536 (GRCm39) splice site probably benign
IGL03150:Trmt1l APN 1 151,329,643 (GRCm39) missense probably benign 0.00
IGL03220:Trmt1l APN 1 151,316,692 (GRCm39) splice site probably benign
Canyonlands UTSW 1 151,329,799 (GRCm39) nonsense probably null
splendiforous UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151,333,681 (GRCm39) missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0240:Trmt1l UTSW 1 151,333,205 (GRCm39) unclassified probably benign
R0267:Trmt1l UTSW 1 151,333,426 (GRCm39) unclassified probably benign
R2084:Trmt1l UTSW 1 151,316,605 (GRCm39) missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151,311,594 (GRCm39) critical splice donor site probably null
R2338:Trmt1l UTSW 1 151,304,710 (GRCm39) intron probably benign
R2408:Trmt1l UTSW 1 151,315,267 (GRCm39) missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151,309,581 (GRCm39) missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151,329,696 (GRCm39) missense probably benign 0.14
R3972:Trmt1l UTSW 1 151,309,634 (GRCm39) missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151,330,784 (GRCm39) missense probably benign 0.18
R4361:Trmt1l UTSW 1 151,311,626 (GRCm39) intron probably benign
R4411:Trmt1l UTSW 1 151,327,905 (GRCm39) missense probably benign 0.02
R4419:Trmt1l UTSW 1 151,316,559 (GRCm39) missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151,324,094 (GRCm39) nonsense probably null
R4614:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4617:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4618:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4653:Trmt1l UTSW 1 151,315,320 (GRCm39) missense probably benign 0.00
R4734:Trmt1l UTSW 1 151,318,388 (GRCm39) missense probably benign 0.32
R4873:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R4875:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R5026:Trmt1l UTSW 1 151,316,627 (GRCm39) missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151,330,746 (GRCm39) missense probably benign
R5587:Trmt1l UTSW 1 151,311,455 (GRCm39) intron probably benign
R5872:Trmt1l UTSW 1 151,316,594 (GRCm39) missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151,304,704 (GRCm39) intron probably benign
R6333:Trmt1l UTSW 1 151,329,685 (GRCm39) missense probably benign 0.15
R6906:Trmt1l UTSW 1 151,327,926 (GRCm39) missense probably benign 0.03
R7269:Trmt1l UTSW 1 151,333,539 (GRCm39) missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151,316,591 (GRCm39) missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151,316,639 (GRCm39) missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151,318,425 (GRCm39) missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151,311,489 (GRCm39) missense probably benign 0.02
R8257:Trmt1l UTSW 1 151,304,629 (GRCm39) start codon destroyed probably null
R8286:Trmt1l UTSW 1 151,333,543 (GRCm39) missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151,325,727 (GRCm39) missense probably benign 0.10
R8451:Trmt1l UTSW 1 151,324,039 (GRCm39) missense unknown
R8514:Trmt1l UTSW 1 151,329,742 (GRCm39) missense probably damaging 0.98
R9287:Trmt1l UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151,325,817 (GRCm39) missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151,304,710 (GRCm39) nonsense probably null
X0039:Trmt1l UTSW 1 151,330,741 (GRCm39) missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151,328,864 (GRCm39) missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTCGCAAGCAGGCTTTCGAG -3'
(R):5'- CCCAGTCAGAAACTTGGCTTC -3'

Sequencing Primer
(F):5'- TCGAGTAAGCCGAACTCACTTTG -3'
(R):5'- CCAGTCAGAAACTTGGCTTCAAATG -3'
Posted On 2015-10-08