Incidental Mutation 'R4647:Tnn'
ID 350315
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 041908-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.396) question?
Stock # R4647 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 159973612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 252 (M252V)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably benign
Transcript: ENSMUST00000039178
AA Change: M252V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: M252V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
AA Change: M252V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: M252V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
Aatf T C 11: 84,362,023 (GRCm39) D313G possibly damaging Het
Abcb11 T G 2: 69,115,615 (GRCm39) D583A probably damaging Het
Adgrv1 A T 13: 81,676,914 (GRCm39) Y1252* probably null Het
Aim2 T C 1: 173,283,090 (GRCm39) silent Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd27 C T 7: 35,337,659 (GRCm39) P991L probably benign Het
Ap1s3 C T 1: 79,591,920 (GRCm39) probably null Het
Apbb1 A C 7: 105,214,745 (GRCm39) S500A probably benign Het
Arc G A 15: 74,543,374 (GRCm39) A283V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
C1qtnf4 T A 2: 90,719,996 (GRCm39) S90T probably damaging Het
Cachd1 A T 4: 100,810,327 (GRCm39) K310* probably null Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Carmil1 G A 13: 24,321,162 (GRCm39) L278F probably damaging Het
Ccar1 A T 10: 62,583,196 (GRCm39) Y972* probably null Het
Cd163 C T 6: 124,297,580 (GRCm39) P909S probably damaging Het
Cd44 T A 2: 102,668,274 (GRCm39) H268L possibly damaging Het
Cdkl2 A T 5: 92,165,072 (GRCm39) L517Q probably damaging Het
Cep68 G T 11: 20,189,349 (GRCm39) N554K probably benign Het
Ces1d A G 8: 93,893,038 (GRCm39) W515R probably damaging Het
Clca4b A C 3: 144,634,286 (GRCm39) H102Q probably benign Het
Cldn15 T A 5: 137,003,337 (GRCm39) I142N probably damaging Het
Cmklr1 T A 5: 113,752,701 (GRCm39) D100V probably damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
D430041D05Rik G A 2: 104,088,788 (GRCm39) P63S probably damaging Het
Ddx39a A T 8: 84,448,902 (GRCm39) H259L probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dimt1 A T 13: 107,084,163 (GRCm39) D50V probably benign Het
Dock9 A T 14: 121,823,658 (GRCm39) L1428H probably damaging Het
Dpp4 G T 2: 62,164,949 (GRCm39) T700K probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Eea1 A G 10: 95,864,255 (GRCm39) T925A probably benign Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Fam171a1 G A 2: 3,221,328 (GRCm39) E140K probably damaging Het
Fgfr3 C T 5: 33,892,330 (GRCm39) probably benign Het
Gabra6 A G 11: 42,198,199 (GRCm39) I407T probably damaging Het
Gm16223 C A 5: 42,371,954 (GRCm39) L115M unknown Het
Gm4781 G T 10: 100,232,862 (GRCm39) noncoding transcript Het
Gm9772 T A 17: 22,226,013 (GRCm39) I70F possibly damaging Het
Gpr107 T A 2: 31,100,513 (GRCm39) F497Y probably damaging Het
Grm7 T A 6: 110,891,344 (GRCm39) Y192* probably null Het
Gtf2ird2 G A 5: 134,245,034 (GRCm39) A431T probably damaging Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
H2-M11 T A 17: 36,858,883 (GRCm39) V141D probably benign Het
Hmcn1 A G 1: 150,551,262 (GRCm39) probably null Het
Hmcn2 A T 2: 31,289,031 (GRCm39) Q2280L possibly damaging Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Igfbp7 T A 5: 77,499,143 (GRCm39) Q285L possibly damaging Het
Igkv13-85 T A 6: 68,907,720 (GRCm39) probably benign Het
Inpp5e A T 2: 26,297,926 (GRCm39) L225H probably benign Het
Inpp5f T A 7: 128,260,833 (GRCm39) V91E possibly damaging Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Klra5 T A 6: 129,876,339 (GRCm39) D156V probably damaging Het
Kmo C A 1: 175,487,340 (GRCm39) Y430* probably null Het
Lbx2 A G 6: 83,065,027 (GRCm39) D188G probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lrrc45 T A 11: 120,609,947 (GRCm39) S464T probably benign Het
Ltc4s T A 11: 50,128,052 (GRCm39) T61S probably benign Het
Luc7l3 A C 11: 94,200,467 (GRCm39) N50K probably damaging Het
Ly75 G A 2: 60,138,622 (GRCm39) T1415M probably damaging Het
Macf1 T C 4: 123,367,420 (GRCm39) E2447G probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mbtd1 C T 11: 93,815,437 (GRCm39) H342Y probably damaging Het
Mest C T 6: 30,745,109 (GRCm39) R226* probably null Het
Mindy1 A T 3: 95,190,054 (GRCm39) probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mn1 A G 5: 111,567,949 (GRCm39) T640A probably benign Het
Msi2 T C 11: 88,608,864 (GRCm39) H18R possibly damaging Het
Myo18a T A 11: 77,708,776 (GRCm39) V61E probably damaging Het
Myo19 T G 11: 84,785,468 (GRCm39) I237S probably damaging Het
Ncaph2 T A 15: 89,254,635 (GRCm39) L416Q probably damaging Het
Nlrp1a T A 11: 70,987,952 (GRCm39) probably null Het
Or1n1b A G 2: 36,780,663 (GRCm39) F66L probably benign Het
Or2d4 A T 7: 106,543,547 (GRCm39) N220K probably benign Het
Or51a25 A G 7: 102,373,299 (GRCm39) S133P probably damaging Het
Or5b98 A G 19: 12,931,441 (GRCm39) I163V probably benign Het
Or8s10 G T 15: 98,335,457 (GRCm39) V36F probably benign Het
Padi2 T C 4: 140,671,757 (GRCm39) F495S probably damaging Het
Pan3 G T 5: 147,464,013 (GRCm39) D535Y probably damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl1 T A 19: 11,891,798 (GRCm39) D34E probably damaging Het
Pcdha6 A T 18: 37,102,189 (GRCm39) T461S probably damaging Het
Pcnt T C 10: 76,190,047 (GRCm39) S2830G probably benign Het
Pdgfa G A 5: 138,964,939 (GRCm39) T181I probably benign Het
Pds5a C A 5: 65,813,661 (GRCm39) D275Y probably damaging Het
Plod2 T A 9: 92,487,503 (GRCm39) Y607* probably null Het
Pomt2 G T 12: 87,164,857 (GRCm39) T517K possibly damaging Het
Pramel23 T C 4: 143,425,914 (GRCm39) M10V probably benign Het
Prdm1 T C 10: 44,315,686 (GRCm39) T817A probably damaging Het
Prdm2 T C 4: 142,859,525 (GRCm39) D1255G possibly damaging Het
Prex2 T A 1: 11,232,509 (GRCm39) C859S probably damaging Het
Ralgapa2 A T 2: 146,229,549 (GRCm39) M1077K possibly damaging Het
Ralgds T C 2: 28,435,532 (GRCm39) probably null Het
Rasa3 T C 8: 13,638,865 (GRCm39) E314G probably null Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rnf139 A T 15: 58,771,836 (GRCm39) L620F probably benign Het
Rptor T A 11: 119,781,989 (GRCm39) N1105K probably benign Het
Scaf11 A T 15: 96,317,981 (GRCm39) probably null Het
Sectm1b A T 11: 120,946,760 (GRCm39) V45E probably damaging Het
Selenon A G 4: 134,272,968 (GRCm39) W157R probably damaging Het
Sema3b C A 9: 107,476,250 (GRCm39) R657L possibly damaging Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Sh3tc1 C T 5: 35,863,662 (GRCm39) A842T probably damaging Het
Shank2 A G 7: 143,965,566 (GRCm39) E1268G probably damaging Het
Shmt1 G A 11: 60,692,291 (GRCm39) S155F probably damaging Het
Sim2 A G 16: 93,924,385 (GRCm39) E510G possibly damaging Het
Slc25a46 A T 18: 31,733,245 (GRCm39) I168N probably damaging Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Slfn14 G T 11: 83,167,484 (GRCm39) A677E probably benign Het
Slk G T 19: 47,608,713 (GRCm39) Q555H possibly damaging Het
Synj1 A T 16: 90,770,877 (GRCm39) D517E probably damaging Het
Syvn1 G A 19: 6,101,504 (GRCm39) R440Q probably benign Het
Tafa5 T G 15: 87,604,783 (GRCm39) S115A probably damaging Het
Tas2r118 A T 6: 23,969,467 (GRCm39) I198N probably damaging Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Timeless A G 10: 128,075,825 (GRCm39) Y19C possibly damaging Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trmt1l G T 1: 151,333,632 (GRCm39) V712F possibly damaging Het
Tti1 T C 2: 157,848,940 (GRCm39) probably benign Het
Ulk4 T C 9: 120,970,918 (GRCm39) H1018R probably benign Het
Vim A T 2: 13,587,306 (GRCm39) H461L probably benign Het
Vmn2r118 T A 17: 55,917,665 (GRCm39) E282D probably damaging Het
Vmn2r31 T A 7: 7,387,367 (GRCm39) I735F probably damaging Het
Vmn2r88 A G 14: 51,656,250 (GRCm39) M829V probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Wbp2 T A 11: 115,973,207 (GRCm39) M67L probably benign Het
Wdr81 T A 11: 75,336,814 (GRCm39) E1525V probably damaging Het
Xbp1 A G 11: 5,472,006 (GRCm39) D44G probably damaging Het
Zfhx4 T G 3: 5,464,341 (GRCm39) F1500V probably damaging Het
Zfp286 A C 11: 62,674,559 (GRCm39) Y95* probably null Het
Zfp872 A G 9: 22,111,057 (GRCm39) T178A possibly damaging Het
Zkscan5 A G 5: 145,155,640 (GRCm39) H364R possibly damaging Het
Zp3r A T 1: 130,505,697 (GRCm39) Y422N probably damaging Het
Zscan10 C T 17: 23,829,314 (GRCm39) R542C probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1565:Tnn UTSW 1 159,924,835 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4439:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4737:Tnn UTSW 1 159,973,659 (GRCm39) missense probably damaging 1.00
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8335:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8427:Tnn UTSW 1 159,958,256 (GRCm39) missense probably damaging 0.99
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATTCTATCAGAATCAGGACCA -3'
(R):5'- TGTGTGACGCGCCCTATGT -3'

Sequencing Primer
(F):5'- GCAGGAGACCCAGGACTTTATTC -3'
(R):5'- CCTATGTGGGGGTCGACTGC -3'
Posted On 2015-10-08