Incidental Mutation 'R4647:Ly75'
ID350325
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
MMRRC Submission 041908-MU
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4647 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60308278 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1415 (T1415M)
Ref Sequence ENSEMBL: ENSMUSP00000108152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: T1415M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: T1415M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: T1415M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: T1415M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
Aatf T C 11: 84,471,197 D313G possibly damaging Het
Abcb11 T G 2: 69,285,271 D583A probably damaging Het
Adgrv1 A T 13: 81,528,795 Y1252* probably null Het
Aim2 T C 1: 173,455,524 silent Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd27 C T 7: 35,638,234 P991L probably benign Het
Ap1s3 C T 1: 79,614,203 probably null Het
Apbb1 A C 7: 105,565,538 S500A probably benign Het
Arc G A 15: 74,671,525 A283V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C1qtnf4 T A 2: 90,889,652 S90T probably damaging Het
Cachd1 A T 4: 100,953,130 K310* probably null Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Carmil1 G A 13: 24,137,179 L278F probably damaging Het
Ccar1 A T 10: 62,747,417 Y972* probably null Het
Cd163 C T 6: 124,320,621 P909S probably damaging Het
Cd44 T A 2: 102,837,929 H268L possibly damaging Het
Cdkl2 A T 5: 92,017,213 L517Q probably damaging Het
Cep68 G T 11: 20,239,349 N554K probably benign Het
Ces1d A G 8: 93,166,410 W515R probably damaging Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cldn15 T A 5: 136,974,483 I142N probably damaging Het
Cmklr1 T A 5: 113,614,640 D100V probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
D430041D05Rik G A 2: 104,258,443 P63S probably damaging Het
Ddx39 A T 8: 83,722,273 H259L probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dimt1 A T 13: 106,947,655 D50V probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dpp4 G T 2: 62,334,605 T700K probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Eea1 A G 10: 96,028,393 T925A probably benign Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Fam171a1 G A 2: 3,220,291 E140K probably damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fgfr3 C T 5: 33,734,986 probably benign Het
Gabra6 A G 11: 42,307,372 I407T probably damaging Het
Gm13089 T C 4: 143,699,344 M10V probably benign Het
Gm16223 C A 5: 42,214,611 L115M unknown Het
Gm4781 G T 10: 100,397,000 noncoding transcript Het
Gm9772 T A 17: 22,007,032 I70F possibly damaging Het
Gpr107 T A 2: 31,210,501 F497Y probably damaging Het
Grm7 T A 6: 110,914,383 Y192* probably null Het
Gtf2ird2 G A 5: 134,216,192 A431T probably damaging Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
H2-M11 T A 17: 36,547,991 V141D probably benign Het
Hmcn1 A G 1: 150,675,511 probably null Het
Hmcn2 A T 2: 31,399,019 Q2280L possibly damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Igfbp7 T A 5: 77,351,296 Q285L possibly damaging Het
Igkv13-85 T A 6: 68,930,736 probably benign Het
Inpp5e A T 2: 26,407,914 L225H probably benign Het
Inpp5f T A 7: 128,659,109 V91E possibly damaging Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Klra5 T A 6: 129,899,376 D156V probably damaging Het
Kmo C A 1: 175,659,774 Y430* probably null Het
Lbx2 A G 6: 83,088,046 D188G probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lrrc45 T A 11: 120,719,121 S464T probably benign Het
Ltc4s T A 11: 50,237,225 T61S probably benign Het
Luc7l3 A C 11: 94,309,641 N50K probably damaging Het
Macf1 T C 4: 123,473,627 E2447G probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mbtd1 C T 11: 93,924,611 H342Y probably damaging Het
Mest C T 6: 30,745,110 R226* probably null Het
Mindy1 A T 3: 95,282,743 probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mn1 A G 5: 111,420,083 T640A probably benign Het
Msi2 T C 11: 88,718,038 H18R possibly damaging Het
Myo18a T A 11: 77,817,950 V61E probably damaging Het
Myo19 T G 11: 84,894,642 I237S probably damaging Het
Ncaph2 T A 15: 89,370,432 L416Q probably damaging Het
Nlrp1a T A 11: 71,097,126 probably null Het
Olfr1450 A G 19: 12,954,077 I163V probably benign Het
Olfr282 G T 15: 98,437,576 V36F probably benign Het
Olfr353 A G 2: 36,890,651 F66L probably benign Het
Olfr559 A G 7: 102,724,092 S133P probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Padi2 T C 4: 140,944,446 F495S probably damaging Het
Pan3 G T 5: 147,527,203 D535Y probably damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl1 T A 19: 11,914,434 D34E probably damaging Het
Pcdha6 A T 18: 36,969,136 T461S probably damaging Het
Pcnt T C 10: 76,354,213 S2830G probably benign Het
Pdgfa G A 5: 138,979,184 T181I probably benign Het
Pds5a C A 5: 65,656,318 D275Y probably damaging Het
Plod2 T A 9: 92,605,450 Y607* probably null Het
Pomt2 G T 12: 87,118,083 T517K possibly damaging Het
Prdm1 T C 10: 44,439,690 T817A probably damaging Het
Prdm2 T C 4: 143,132,955 D1255G possibly damaging Het
Prex2 T A 1: 11,162,285 C859S probably damaging Het
Ralgapa2 A T 2: 146,387,629 M1077K possibly damaging Het
Ralgds T C 2: 28,545,520 probably null Het
Rasa3 T C 8: 13,588,865 E314G probably null Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rnf139 A T 15: 58,899,987 L620F probably benign Het
Rptor T A 11: 119,891,163 N1105K probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Sectm1b A T 11: 121,055,934 V45E probably damaging Het
Selenon A G 4: 134,545,657 W157R probably damaging Het
Sema3b C A 9: 107,599,051 R657L possibly damaging Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Sh3tc1 C T 5: 35,706,318 A842T probably damaging Het
Shank2 A G 7: 144,411,829 E1268G probably damaging Het
Shmt1 G A 11: 60,801,465 S155F probably damaging Het
Sim2 A G 16: 94,123,526 E510G possibly damaging Het
Slc25a46 A T 18: 31,600,192 I168N probably damaging Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Slfn14 G T 11: 83,276,658 A677E probably benign Het
Slk G T 19: 47,620,274 Q555H possibly damaging Het
Synj1 A T 16: 90,973,989 D517E probably damaging Het
Syvn1 G A 19: 6,051,474 R440Q probably benign Het
Tas2r118 A T 6: 23,969,468 I198N probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Timeless A G 10: 128,239,956 Y19C possibly damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trmt1l G T 1: 151,457,881 V712F possibly damaging Het
Tti1 T C 2: 158,007,020 probably benign Het
Ulk4 T C 9: 121,141,852 H1018R probably benign Het
Vim A T 2: 13,582,495 H461L probably benign Het
Vmn2r118 T A 17: 55,610,665 E282D probably damaging Het
Vmn2r31 T A 7: 7,384,368 I735F probably damaging Het
Vmn2r88 A G 14: 51,418,793 M829V probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp2 T A 11: 116,082,381 M67L probably benign Het
Wdr81 T A 11: 75,445,988 E1525V probably damaging Het
Xbp1 A G 11: 5,522,006 D44G probably damaging Het
Zfhx4 T G 3: 5,399,281 F1500V probably damaging Het
Zfp286 A C 11: 62,783,733 Y95* probably null Het
Zfp872 A G 9: 22,199,761 T178A possibly damaging Het
Zkscan5 A G 5: 145,218,830 H364R possibly damaging Het
Zp3r A T 1: 130,577,960 Y422N probably damaging Het
Zscan10 C T 17: 23,610,340 R542C probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 unclassified probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAAATTTCTGGAAGCAAATGG -3'
(R):5'- AGTCAGCCTCACATGTCCAAG -3'

Sequencing Primer
(F):5'- GGACTTACATCATGACTTGAGAGCC -3'
(R):5'- TGAGGACAAACACAATGGC -3'
Posted On2015-10-08