Incidental Mutation 'R4647:Ralgapa2'
ID350332
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 041908-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4647 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146387629 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1077 (M1077K)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109986
AA Change: M1030K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: M1030K

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131824
AA Change: M992K

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: M992K

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146307
AA Change: M18K
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: M18K

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148784
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: M662K
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: M662K

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228797
AA Change: M1077K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
Aatf T C 11: 84,471,197 D313G possibly damaging Het
Abcb11 T G 2: 69,285,271 D583A probably damaging Het
Adgrv1 A T 13: 81,528,795 Y1252* probably null Het
Aim2 T C 1: 173,455,524 silent Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd27 C T 7: 35,638,234 P991L probably benign Het
Ap1s3 C T 1: 79,614,203 probably null Het
Apbb1 A C 7: 105,565,538 S500A probably benign Het
Arc G A 15: 74,671,525 A283V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C1qtnf4 T A 2: 90,889,652 S90T probably damaging Het
Cachd1 A T 4: 100,953,130 K310* probably null Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Carmil1 G A 13: 24,137,179 L278F probably damaging Het
Ccar1 A T 10: 62,747,417 Y972* probably null Het
Cd163 C T 6: 124,320,621 P909S probably damaging Het
Cd44 T A 2: 102,837,929 H268L possibly damaging Het
Cdkl2 A T 5: 92,017,213 L517Q probably damaging Het
Cep68 G T 11: 20,239,349 N554K probably benign Het
Ces1d A G 8: 93,166,410 W515R probably damaging Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cldn15 T A 5: 136,974,483 I142N probably damaging Het
Cmklr1 T A 5: 113,614,640 D100V probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
D430041D05Rik G A 2: 104,258,443 P63S probably damaging Het
Ddx39 A T 8: 83,722,273 H259L probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dimt1 A T 13: 106,947,655 D50V probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dpp4 G T 2: 62,334,605 T700K probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Eea1 A G 10: 96,028,393 T925A probably benign Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Fam171a1 G A 2: 3,220,291 E140K probably damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fgfr3 C T 5: 33,734,986 probably benign Het
Gabra6 A G 11: 42,307,372 I407T probably damaging Het
Gm13089 T C 4: 143,699,344 M10V probably benign Het
Gm16223 C A 5: 42,214,611 L115M unknown Het
Gm4781 G T 10: 100,397,000 noncoding transcript Het
Gm9772 T A 17: 22,007,032 I70F possibly damaging Het
Gpr107 T A 2: 31,210,501 F497Y probably damaging Het
Grm7 T A 6: 110,914,383 Y192* probably null Het
Gtf2ird2 G A 5: 134,216,192 A431T probably damaging Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
H2-M11 T A 17: 36,547,991 V141D probably benign Het
Hmcn1 A G 1: 150,675,511 probably null Het
Hmcn2 A T 2: 31,399,019 Q2280L possibly damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Igfbp7 T A 5: 77,351,296 Q285L possibly damaging Het
Igkv13-85 T A 6: 68,930,736 probably benign Het
Inpp5e A T 2: 26,407,914 L225H probably benign Het
Inpp5f T A 7: 128,659,109 V91E possibly damaging Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Klra5 T A 6: 129,899,376 D156V probably damaging Het
Kmo C A 1: 175,659,774 Y430* probably null Het
Lbx2 A G 6: 83,088,046 D188G probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lrrc45 T A 11: 120,719,121 S464T probably benign Het
Ltc4s T A 11: 50,237,225 T61S probably benign Het
Luc7l3 A C 11: 94,309,641 N50K probably damaging Het
Ly75 G A 2: 60,308,278 T1415M probably damaging Het
Macf1 T C 4: 123,473,627 E2447G probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mbtd1 C T 11: 93,924,611 H342Y probably damaging Het
Mest C T 6: 30,745,110 R226* probably null Het
Mindy1 A T 3: 95,282,743 probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mn1 A G 5: 111,420,083 T640A probably benign Het
Msi2 T C 11: 88,718,038 H18R possibly damaging Het
Myo18a T A 11: 77,817,950 V61E probably damaging Het
Myo19 T G 11: 84,894,642 I237S probably damaging Het
Ncaph2 T A 15: 89,370,432 L416Q probably damaging Het
Nlrp1a T A 11: 71,097,126 probably null Het
Olfr1450 A G 19: 12,954,077 I163V probably benign Het
Olfr282 G T 15: 98,437,576 V36F probably benign Het
Olfr353 A G 2: 36,890,651 F66L probably benign Het
Olfr559 A G 7: 102,724,092 S133P probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Padi2 T C 4: 140,944,446 F495S probably damaging Het
Pan3 G T 5: 147,527,203 D535Y probably damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl1 T A 19: 11,914,434 D34E probably damaging Het
Pcdha6 A T 18: 36,969,136 T461S probably damaging Het
Pcnt T C 10: 76,354,213 S2830G probably benign Het
Pdgfa G A 5: 138,979,184 T181I probably benign Het
Pds5a C A 5: 65,656,318 D275Y probably damaging Het
Plod2 T A 9: 92,605,450 Y607* probably null Het
Pomt2 G T 12: 87,118,083 T517K possibly damaging Het
Prdm1 T C 10: 44,439,690 T817A probably damaging Het
Prdm2 T C 4: 143,132,955 D1255G possibly damaging Het
Prex2 T A 1: 11,162,285 C859S probably damaging Het
Ralgds T C 2: 28,545,520 probably null Het
Rasa3 T C 8: 13,588,865 E314G probably null Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rnf139 A T 15: 58,899,987 L620F probably benign Het
Rptor T A 11: 119,891,163 N1105K probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Sectm1b A T 11: 121,055,934 V45E probably damaging Het
Selenon A G 4: 134,545,657 W157R probably damaging Het
Sema3b C A 9: 107,599,051 R657L possibly damaging Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Sh3tc1 C T 5: 35,706,318 A842T probably damaging Het
Shank2 A G 7: 144,411,829 E1268G probably damaging Het
Shmt1 G A 11: 60,801,465 S155F probably damaging Het
Sim2 A G 16: 94,123,526 E510G possibly damaging Het
Slc25a46 A T 18: 31,600,192 I168N probably damaging Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Slfn14 G T 11: 83,276,658 A677E probably benign Het
Slk G T 19: 47,620,274 Q555H possibly damaging Het
Synj1 A T 16: 90,973,989 D517E probably damaging Het
Syvn1 G A 19: 6,051,474 R440Q probably benign Het
Tas2r118 A T 6: 23,969,468 I198N probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Timeless A G 10: 128,239,956 Y19C possibly damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trmt1l G T 1: 151,457,881 V712F possibly damaging Het
Tti1 T C 2: 158,007,020 probably benign Het
Ulk4 T C 9: 121,141,852 H1018R probably benign Het
Vim A T 2: 13,582,495 H461L probably benign Het
Vmn2r118 T A 17: 55,610,665 E282D probably damaging Het
Vmn2r31 T A 7: 7,384,368 I735F probably damaging Het
Vmn2r88 A G 14: 51,418,793 M829V probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp2 T A 11: 116,082,381 M67L probably benign Het
Wdr81 T A 11: 75,445,988 E1525V probably damaging Het
Xbp1 A G 11: 5,522,006 D44G probably damaging Het
Zfhx4 T G 3: 5,399,281 F1500V probably damaging Het
Zfp286 A C 11: 62,783,733 Y95* probably null Het
Zfp872 A G 9: 22,199,761 T178A possibly damaging Het
Zkscan5 A G 5: 145,218,830 H364R possibly damaging Het
Zp3r A T 1: 130,577,960 Y422N probably damaging Het
Zscan10 C T 17: 23,610,340 R542C probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
R7663:Ralgapa2 UTSW 2 146418415 missense probably benign 0.01
R7780:Ralgapa2 UTSW 2 146342414 missense probably benign 0.14
RF019:Ralgapa2 UTSW 2 146361503 missense possibly damaging 0.53
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AATCAAGTCCAGATGCAGAGC -3'
(R):5'- TCAGAATCTCTCTAGGTGTTCAC -3'

Sequencing Primer
(F):5'- GCAGAGCATTTCAACATTTCATTTAC -3'
(R):5'- TCAACTACATGTAGTAAGCAAAACAC -3'
Posted On2015-10-08