Incidental Mutation 'R0267:Zdhhc6'
ID35034
Institutional Source Beutler Lab
Gene Symbol Zdhhc6
Ensembl Gene ENSMUSG00000024982
Gene Namezinc finger, DHHC domain containing 6
Synonyms
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0267 (G1)
Quality Score104
Status Validated
Chromosome19
Chromosomal Location55271291-55316032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55308930 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 237 (S237T)
Ref Sequence ENSEMBL: ENSMUSP00000153404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076891] [ENSMUST00000223807] [ENSMUST00000224291] [ENSMUST00000224897] [ENSMUST00000225495] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably benign
Transcript: ENSMUST00000076891
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076157
Gene: ENSMUSG00000024982
AA Change: S237T

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:zf-DHHC 94 244 3.2e-38 PFAM
SH3 316 397 5.84e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223743
Predicted Effect probably benign
Transcript: ENSMUST00000223807
Predicted Effect probably benign
Transcript: ENSMUST00000224291
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224474
Predicted Effect probably benign
Transcript: ENSMUST00000224897
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000225495
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000225963
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000226103
AA Change: S237T

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1403 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Zdhhc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zdhhc6 APN 19 55309892 missense probably benign 0.19
IGL01419:Zdhhc6 APN 19 55309754 missense probably benign 0.09
IGL02598:Zdhhc6 APN 19 55314527 missense probably benign 0.31
Chalcogenide UTSW 19 55311701 missense probably damaging 1.00
pegmatite UTSW 19 55304439 nonsense probably null
telluride UTSW 19 55314566 start codon destroyed probably null 1.00
R0920:Zdhhc6 UTSW 19 55311701 missense probably damaging 1.00
R2143:Zdhhc6 UTSW 19 55298796 missense probably benign
R4445:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4446:Zdhhc6 UTSW 19 55302737 missense probably benign 0.31
R4632:Zdhhc6 UTSW 19 55314309 missense probably damaging 1.00
R4921:Zdhhc6 UTSW 19 55313210 missense probably damaging 0.96
R5144:Zdhhc6 UTSW 19 55314566 start codon destroyed probably null 1.00
R7067:Zdhhc6 UTSW 19 55304439 nonsense probably null
R7266:Zdhhc6 UTSW 19 55304500 missense probably damaging 1.00
R7307:Zdhhc6 UTSW 19 55313250 missense probably damaging 1.00
R7326:Zdhhc6 UTSW 19 55302755 missense possibly damaging 0.88
R8425:Zdhhc6 UTSW 19 55314444 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCCTGCTTGGCTTTCAAGAAC -3'
(R):5'- ACACTGACTGCTGCTTAGCCTCTG -3'

Sequencing Primer
(F):5'- GAATTAACATCTCCATGTCGCTGG -3'
(R):5'- AGCCTCTGCCATCTTTGCTG -3'
Posted On2013-05-09