Incidental Mutation 'R4647:Ulk4'
ID 350386
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 041908-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R4647 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120970918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1018 (H1018R)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: H1018R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: H1018R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: H1018R

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: H1018R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
Aatf T C 11: 84,362,023 (GRCm39) D313G possibly damaging Het
Abcb11 T G 2: 69,115,615 (GRCm39) D583A probably damaging Het
Adgrv1 A T 13: 81,676,914 (GRCm39) Y1252* probably null Het
Aim2 T C 1: 173,283,090 (GRCm39) silent Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd27 C T 7: 35,337,659 (GRCm39) P991L probably benign Het
Ap1s3 C T 1: 79,591,920 (GRCm39) probably null Het
Apbb1 A C 7: 105,214,745 (GRCm39) S500A probably benign Het
Arc G A 15: 74,543,374 (GRCm39) A283V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
C1qtnf4 T A 2: 90,719,996 (GRCm39) S90T probably damaging Het
Cachd1 A T 4: 100,810,327 (GRCm39) K310* probably null Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Carmil1 G A 13: 24,321,162 (GRCm39) L278F probably damaging Het
Ccar1 A T 10: 62,583,196 (GRCm39) Y972* probably null Het
Cd163 C T 6: 124,297,580 (GRCm39) P909S probably damaging Het
Cd44 T A 2: 102,668,274 (GRCm39) H268L possibly damaging Het
Cdkl2 A T 5: 92,165,072 (GRCm39) L517Q probably damaging Het
Cep68 G T 11: 20,189,349 (GRCm39) N554K probably benign Het
Ces1d A G 8: 93,893,038 (GRCm39) W515R probably damaging Het
Clca4b A C 3: 144,634,286 (GRCm39) H102Q probably benign Het
Cldn15 T A 5: 137,003,337 (GRCm39) I142N probably damaging Het
Cmklr1 T A 5: 113,752,701 (GRCm39) D100V probably damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
D430041D05Rik G A 2: 104,088,788 (GRCm39) P63S probably damaging Het
Ddx39a A T 8: 84,448,902 (GRCm39) H259L probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dimt1 A T 13: 107,084,163 (GRCm39) D50V probably benign Het
Dock9 A T 14: 121,823,658 (GRCm39) L1428H probably damaging Het
Dpp4 G T 2: 62,164,949 (GRCm39) T700K probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Eea1 A G 10: 95,864,255 (GRCm39) T925A probably benign Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Fam171a1 G A 2: 3,221,328 (GRCm39) E140K probably damaging Het
Fgfr3 C T 5: 33,892,330 (GRCm39) probably benign Het
Gabra6 A G 11: 42,198,199 (GRCm39) I407T probably damaging Het
Gm16223 C A 5: 42,371,954 (GRCm39) L115M unknown Het
Gm4781 G T 10: 100,232,862 (GRCm39) noncoding transcript Het
Gm9772 T A 17: 22,226,013 (GRCm39) I70F possibly damaging Het
Gpr107 T A 2: 31,100,513 (GRCm39) F497Y probably damaging Het
Grm7 T A 6: 110,891,344 (GRCm39) Y192* probably null Het
Gtf2ird2 G A 5: 134,245,034 (GRCm39) A431T probably damaging Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
H2-M11 T A 17: 36,858,883 (GRCm39) V141D probably benign Het
Hmcn1 A G 1: 150,551,262 (GRCm39) probably null Het
Hmcn2 A T 2: 31,289,031 (GRCm39) Q2280L possibly damaging Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Igfbp7 T A 5: 77,499,143 (GRCm39) Q285L possibly damaging Het
Igkv13-85 T A 6: 68,907,720 (GRCm39) probably benign Het
Inpp5e A T 2: 26,297,926 (GRCm39) L225H probably benign Het
Inpp5f T A 7: 128,260,833 (GRCm39) V91E possibly damaging Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Klra5 T A 6: 129,876,339 (GRCm39) D156V probably damaging Het
Kmo C A 1: 175,487,340 (GRCm39) Y430* probably null Het
Lbx2 A G 6: 83,065,027 (GRCm39) D188G probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lrrc45 T A 11: 120,609,947 (GRCm39) S464T probably benign Het
Ltc4s T A 11: 50,128,052 (GRCm39) T61S probably benign Het
Luc7l3 A C 11: 94,200,467 (GRCm39) N50K probably damaging Het
Ly75 G A 2: 60,138,622 (GRCm39) T1415M probably damaging Het
Macf1 T C 4: 123,367,420 (GRCm39) E2447G probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mbtd1 C T 11: 93,815,437 (GRCm39) H342Y probably damaging Het
Mest C T 6: 30,745,109 (GRCm39) R226* probably null Het
Mindy1 A T 3: 95,190,054 (GRCm39) probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mn1 A G 5: 111,567,949 (GRCm39) T640A probably benign Het
Msi2 T C 11: 88,608,864 (GRCm39) H18R possibly damaging Het
Myo18a T A 11: 77,708,776 (GRCm39) V61E probably damaging Het
Myo19 T G 11: 84,785,468 (GRCm39) I237S probably damaging Het
Ncaph2 T A 15: 89,254,635 (GRCm39) L416Q probably damaging Het
Nlrp1a T A 11: 70,987,952 (GRCm39) probably null Het
Or1n1b A G 2: 36,780,663 (GRCm39) F66L probably benign Het
Or2d4 A T 7: 106,543,547 (GRCm39) N220K probably benign Het
Or51a25 A G 7: 102,373,299 (GRCm39) S133P probably damaging Het
Or5b98 A G 19: 12,931,441 (GRCm39) I163V probably benign Het
Or8s10 G T 15: 98,335,457 (GRCm39) V36F probably benign Het
Padi2 T C 4: 140,671,757 (GRCm39) F495S probably damaging Het
Pan3 G T 5: 147,464,013 (GRCm39) D535Y probably damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl1 T A 19: 11,891,798 (GRCm39) D34E probably damaging Het
Pcdha6 A T 18: 37,102,189 (GRCm39) T461S probably damaging Het
Pcnt T C 10: 76,190,047 (GRCm39) S2830G probably benign Het
Pdgfa G A 5: 138,964,939 (GRCm39) T181I probably benign Het
Pds5a C A 5: 65,813,661 (GRCm39) D275Y probably damaging Het
Plod2 T A 9: 92,487,503 (GRCm39) Y607* probably null Het
Pomt2 G T 12: 87,164,857 (GRCm39) T517K possibly damaging Het
Pramel23 T C 4: 143,425,914 (GRCm39) M10V probably benign Het
Prdm1 T C 10: 44,315,686 (GRCm39) T817A probably damaging Het
Prdm2 T C 4: 142,859,525 (GRCm39) D1255G possibly damaging Het
Prex2 T A 1: 11,232,509 (GRCm39) C859S probably damaging Het
Ralgapa2 A T 2: 146,229,549 (GRCm39) M1077K possibly damaging Het
Ralgds T C 2: 28,435,532 (GRCm39) probably null Het
Rasa3 T C 8: 13,638,865 (GRCm39) E314G probably null Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rnf139 A T 15: 58,771,836 (GRCm39) L620F probably benign Het
Rptor T A 11: 119,781,989 (GRCm39) N1105K probably benign Het
Scaf11 A T 15: 96,317,981 (GRCm39) probably null Het
Sectm1b A T 11: 120,946,760 (GRCm39) V45E probably damaging Het
Selenon A G 4: 134,272,968 (GRCm39) W157R probably damaging Het
Sema3b C A 9: 107,476,250 (GRCm39) R657L possibly damaging Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Sh3tc1 C T 5: 35,863,662 (GRCm39) A842T probably damaging Het
Shank2 A G 7: 143,965,566 (GRCm39) E1268G probably damaging Het
Shmt1 G A 11: 60,692,291 (GRCm39) S155F probably damaging Het
Sim2 A G 16: 93,924,385 (GRCm39) E510G possibly damaging Het
Slc25a46 A T 18: 31,733,245 (GRCm39) I168N probably damaging Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Slfn14 G T 11: 83,167,484 (GRCm39) A677E probably benign Het
Slk G T 19: 47,608,713 (GRCm39) Q555H possibly damaging Het
Synj1 A T 16: 90,770,877 (GRCm39) D517E probably damaging Het
Syvn1 G A 19: 6,101,504 (GRCm39) R440Q probably benign Het
Tafa5 T G 15: 87,604,783 (GRCm39) S115A probably damaging Het
Tas2r118 A T 6: 23,969,467 (GRCm39) I198N probably damaging Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Timeless A G 10: 128,075,825 (GRCm39) Y19C possibly damaging Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trmt1l G T 1: 151,333,632 (GRCm39) V712F possibly damaging Het
Tti1 T C 2: 157,848,940 (GRCm39) probably benign Het
Vim A T 2: 13,587,306 (GRCm39) H461L probably benign Het
Vmn2r118 T A 17: 55,917,665 (GRCm39) E282D probably damaging Het
Vmn2r31 T A 7: 7,387,367 (GRCm39) I735F probably damaging Het
Vmn2r88 A G 14: 51,656,250 (GRCm39) M829V probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Wbp2 T A 11: 115,973,207 (GRCm39) M67L probably benign Het
Wdr81 T A 11: 75,336,814 (GRCm39) E1525V probably damaging Het
Xbp1 A G 11: 5,472,006 (GRCm39) D44G probably damaging Het
Zfhx4 T G 3: 5,464,341 (GRCm39) F1500V probably damaging Het
Zfp286 A C 11: 62,674,559 (GRCm39) Y95* probably null Het
Zfp872 A G 9: 22,111,057 (GRCm39) T178A possibly damaging Het
Zkscan5 A G 5: 145,155,640 (GRCm39) H364R possibly damaging Het
Zp3r A T 1: 130,505,697 (GRCm39) Y422N probably damaging Het
Zscan10 C T 17: 23,829,314 (GRCm39) R542C probably benign Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCTAACTCAGGCCTCCG -3'
(R):5'- ATCTGTGCGAGTGCTATGC -3'

Sequencing Primer
(F):5'- AACTCCACACTTCCTCAGTTTGAAG -3'
(R):5'- TGCGAGTGCTATGCTCATAG -3'
Posted On 2015-10-08