Mutagenetix > Incidental Mutation

Incidental Mutation 'R0268:Rif1'

35040

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

038494-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0268 (G1)

Quality Score

107

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 52090286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069794

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112693

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112693

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 98.7%
3x: 97.7%
10x: 95.9%
20x: 93.0%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	T	A	7: 29,574,602		noncoding transcript	Het
5430419D17Rik	A	G	7: 131,238,176	D609G	probably damaging	Het
Aadacl4	A	T	4: 144,622,995	H274L	probably benign	Het
Aldh1a7	T	A	19: 20,709,502		probably null	Het
Ap3m1	A	C	14: 21,037,102		probably benign	Het
Atp5a1	C	A	18: 77,780,195	N356K	probably damaging	Het
AU021092	A	T	16: 5,222,167	M31K	possibly damaging	Het
Avpr1a	T	C	10: 122,449,709	V302A	probably damaging	Het
Bicral	A	G	17: 46,814,052		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Casp8ap2	A	T	4: 32,644,079	I1051F	probably damaging	Het
Cd209e	T	C	8: 3,849,125	I196V	probably benign	Het
Cdc42bpa	G	T	1: 180,155,782		probably benign	Het
Clec16a	T	A	16: 10,644,828	L670*	probably null	Het
Cmtm2b	A	G	8: 104,322,434	E27G	probably damaging	Het
Col4a1	T	A	8: 11,267,588		probably benign	Het
Cyp26b1	A	T	6: 84,574,572	F221I	probably damaging	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Dennd6b	T	C	15: 89,196,229	Q56R	probably benign	Het
Dip2c	G	A	13: 9,637,150	R1270H	probably damaging	Het
Dlg1	T	C	16: 31,684,193	C73R	probably benign	Het
Dnah8	A	G	17: 30,769,707	D3217G	probably damaging	Het
Dtx1	T	C	5: 120,681,291	E614G	probably damaging	Het
Dut	C	A	2: 125,257,091	A166E	probably damaging	Het
Ebf1	C	A	11: 44,643,413	D166E	probably damaging	Het
Egln2	A	T	7: 27,165,247	D84E	possibly damaging	Het
Exosc7	T	A	9: 123,118,960	S65T	probably benign	Het
Fam83e	G	A	7: 45,726,910	R349Q	probably benign	Het
Fbxl17	G	A	17: 63,385,067		probably benign	Het
Fras1	A	G	5: 96,737,009	N2582S	probably damaging	Het
Fubp1	T	C	3: 152,219,713	V164A	probably damaging	Het
Gfral	A	T	9: 76,197,101	C210S	probably damaging	Het
Gls	GGCTGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTGCTG	1: 52,232,694		probably benign	Het
Gm13084	A	T	4: 143,810,768	I331N	probably damaging	Het
Hcn4	A	C	9: 58,860,162	E1002A	unknown	Het
Hcrtr2	A	G	9: 76,228,188	V449A	probably benign	Het
Hectd1	C	A	12: 51,769,107	S1394I	probably damaging	Het
Hectd1	T	C	12: 51,769,108	S1394G	possibly damaging	Het
Hecw2	A	G	1: 53,926,698		probably benign	Het
Herc3	A	G	6: 58,868,628		probably benign	Het
Ipo4	T	C	14: 55,625,942	Q1073R	possibly damaging	Het
Itsn2	G	A	12: 4,700,333	R1199Q	probably benign	Het
Kcnj3	C	A	2: 55,594,959	Y356*	probably null	Het
Klb	T	A	5: 65,348,837	D142E	probably benign	Het
Klhl35	T	A	7: 99,471,751	S409T	probably benign	Het
Krt16	T	A	11: 100,246,525		probably benign	Het
Krt82	C	A	15: 101,541,713	R516L	probably benign	Het
Lce3a	A	T	3: 92,925,731	C21S	unknown	Het
Lims2	A	G	18: 31,944,520	E103G	probably benign	Het
Map2	A	T	1: 66,380,722	K71*	probably null	Het
Mthfr	C	G	4: 148,055,428	S618W	probably damaging	Het
Mycbp2	T	A	14: 103,314,325	R157*	probably null	Het
Nat10	C	A	2: 103,727,917		probably benign	Het
Obscn	G	A	11: 59,067,272	T3810M	possibly damaging	Het
Olfr1161	A	T	2: 88,025,468	I249F	probably damaging	Het
Olfr1354	C	T	10: 78,917,605	T255I	probably damaging	Het
Olfr1375	T	A	11: 51,048,941	M278K	probably damaging	Het
Olfr525	G	A	7: 140,323,155	S152N	possibly damaging	Het
Olfr799	A	T	10: 129,647,176	D16V	possibly damaging	Het
Olfr998	A	G	2: 85,591,301	T254A	possibly damaging	Het
Park7	A	G	4: 150,908,349	V20A	possibly damaging	Het
Pgm1	T	A	5: 64,105,808	V266E	probably damaging	Het
Phip	G	A	9: 82,871,288	T1801I	probably damaging	Het
Pkhd1l1	C	A	15: 44,597,011	H4205Q	probably benign	Het
Ppp1r12a	T	A	10: 108,273,381		probably benign	Het
Ppp1r32	A	G	19: 10,477,085	V329A	possibly damaging	Het
Ptprq	A	T	10: 107,705,548	D372E	probably benign	Het
Ptprr	G	A	10: 116,252,963	V340I	possibly damaging	Het
Qk	A	G	17: 10,209,646		probably benign	Het
Qpct	T	A	17: 79,077,652	D240E	probably benign	Het
Ren1	A	G	1: 133,355,611	T162A	possibly damaging	Het
Sart3	A	G	5: 113,752,399	V461A	probably damaging	Het
Scgb1b24	G	A	7: 33,743,853	G19R	probably null	Het
Spen	A	T	4: 141,477,557	I1253N	unknown	Het
Sspo	C	A	6: 48,465,555	H1995N	probably benign	Het
Tfap2c	A	G	2: 172,551,503	T113A	probably benign	Het
Togaram2	T	C	17: 71,697,998		probably null	Het
Trim65	T	A	11: 116,126,644		probably benign	Het
Trpm3	T	A	19: 22,897,521		probably null	Het
Ubxn7	T	C	16: 32,360,046	I87T	probably benign	Het
Vav1	T	C	17: 57,296,090	F81L	probably damaging	Het
Vmn2r102	A	G	17: 19,677,850	T376A	probably benign	Het
Vmn2r105	A	T	17: 20,208,676	C713S	probably benign	Het
Zbtb45	C	T	7: 13,008,327	M1I	probably null	Het
Zfp229	A	T	17: 21,745,841	M351L	probably benign	Het
Zfp932	T	C	5: 110,009,063	I176T	probably benign	Het
Zswim1	G	A	2: 164,826,126	E433K	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAATGAGCGCGTAAATACTCCGT -3'
(R):5'- ATTTGAGCTTCCTTCAAAGCCCACT -3'

Sequencing Primer
(F):5'- gtgtgggtgtgggtggg -3'
(R):5'- agatggctcaatgggtaaagg -3'

Posted On

2013-05-09