Incidental Mutation 'R4647:Wbp2'
ID350414
Institutional Source Beutler Lab
Gene Symbol Wbp2
Ensembl Gene ENSMUSG00000034341
Gene NameWW domain binding protein 2
Synonyms
MMRRC Submission 041908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4647 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116078573-116086995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116082381 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 67 (M67L)
Ref Sequence ENSEMBL: ENSMUSP00000102052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106444] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000156545] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably benign
Transcript: ENSMUST00000074628
AA Change: M67L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341
AA Change: M67L

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106444
AA Change: M67L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102052
Gene: ENSMUSG00000034341
AA Change: M67L

DomainStartEndE-ValueType
Pfam:GRAM 1 84 2.3e-19 PFAM
Pfam:WWbp 100 212 5.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155120
Predicted Effect probably benign
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein that is a transcriptional coactivator of estrogen receptor alpha and progesterone receptor. Defects in this gene have been associated with hearing impairment. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a null allele show progressive high-frequency hearing loss, raised auditory brainstem response (ABR) thresholds, reduced ABR amplitudes, swelling of afferent terminals, inner hair cell synapse defects, and altered expression of AMPA receptor subunits and post-synaptic proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
Aatf T C 11: 84,471,197 D313G possibly damaging Het
Abcb11 T G 2: 69,285,271 D583A probably damaging Het
Adgrv1 A T 13: 81,528,795 Y1252* probably null Het
Aim2 T C 1: 173,455,524 silent Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd27 C T 7: 35,638,234 P991L probably benign Het
Ap1s3 C T 1: 79,614,203 probably null Het
Apbb1 A C 7: 105,565,538 S500A probably benign Het
Arc G A 15: 74,671,525 A283V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C1qtnf4 T A 2: 90,889,652 S90T probably damaging Het
Cachd1 A T 4: 100,953,130 K310* probably null Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Carmil1 G A 13: 24,137,179 L278F probably damaging Het
Ccar1 A T 10: 62,747,417 Y972* probably null Het
Cd163 C T 6: 124,320,621 P909S probably damaging Het
Cd44 T A 2: 102,837,929 H268L possibly damaging Het
Cdkl2 A T 5: 92,017,213 L517Q probably damaging Het
Cep68 G T 11: 20,239,349 N554K probably benign Het
Ces1d A G 8: 93,166,410 W515R probably damaging Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cldn15 T A 5: 136,974,483 I142N probably damaging Het
Cmklr1 T A 5: 113,614,640 D100V probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
D430041D05Rik G A 2: 104,258,443 P63S probably damaging Het
Ddx39 A T 8: 83,722,273 H259L probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dimt1 A T 13: 106,947,655 D50V probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dpp4 G T 2: 62,334,605 T700K probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Eea1 A G 10: 96,028,393 T925A probably benign Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Fam171a1 G A 2: 3,220,291 E140K probably damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fgfr3 C T 5: 33,734,986 probably benign Het
Gabra6 A G 11: 42,307,372 I407T probably damaging Het
Gm13089 T C 4: 143,699,344 M10V probably benign Het
Gm16223 C A 5: 42,214,611 L115M unknown Het
Gm4781 G T 10: 100,397,000 noncoding transcript Het
Gm9772 T A 17: 22,007,032 I70F possibly damaging Het
Gpr107 T A 2: 31,210,501 F497Y probably damaging Het
Grm7 T A 6: 110,914,383 Y192* probably null Het
Gtf2ird2 G A 5: 134,216,192 A431T probably damaging Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
H2-M11 T A 17: 36,547,991 V141D probably benign Het
Hmcn1 A G 1: 150,675,511 probably null Het
Hmcn2 A T 2: 31,399,019 Q2280L possibly damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Igfbp7 T A 5: 77,351,296 Q285L possibly damaging Het
Igkv13-85 T A 6: 68,930,736 probably benign Het
Inpp5e A T 2: 26,407,914 L225H probably benign Het
Inpp5f T A 7: 128,659,109 V91E possibly damaging Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Klra5 T A 6: 129,899,376 D156V probably damaging Het
Kmo C A 1: 175,659,774 Y430* probably null Het
Lbx2 A G 6: 83,088,046 D188G probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lrrc45 T A 11: 120,719,121 S464T probably benign Het
Ltc4s T A 11: 50,237,225 T61S probably benign Het
Luc7l3 A C 11: 94,309,641 N50K probably damaging Het
Ly75 G A 2: 60,308,278 T1415M probably damaging Het
Macf1 T C 4: 123,473,627 E2447G probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mbtd1 C T 11: 93,924,611 H342Y probably damaging Het
Mest C T 6: 30,745,110 R226* probably null Het
Mindy1 A T 3: 95,282,743 probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mn1 A G 5: 111,420,083 T640A probably benign Het
Msi2 T C 11: 88,718,038 H18R possibly damaging Het
Myo18a T A 11: 77,817,950 V61E probably damaging Het
Myo19 T G 11: 84,894,642 I237S probably damaging Het
Ncaph2 T A 15: 89,370,432 L416Q probably damaging Het
Nlrp1a T A 11: 71,097,126 probably null Het
Olfr1450 A G 19: 12,954,077 I163V probably benign Het
Olfr282 G T 15: 98,437,576 V36F probably benign Het
Olfr353 A G 2: 36,890,651 F66L probably benign Het
Olfr559 A G 7: 102,724,092 S133P probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Padi2 T C 4: 140,944,446 F495S probably damaging Het
Pan3 G T 5: 147,527,203 D535Y probably damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl1 T A 19: 11,914,434 D34E probably damaging Het
Pcdha6 A T 18: 36,969,136 T461S probably damaging Het
Pcnt T C 10: 76,354,213 S2830G probably benign Het
Pdgfa G A 5: 138,979,184 T181I probably benign Het
Pds5a C A 5: 65,656,318 D275Y probably damaging Het
Plod2 T A 9: 92,605,450 Y607* probably null Het
Pomt2 G T 12: 87,118,083 T517K possibly damaging Het
Prdm1 T C 10: 44,439,690 T817A probably damaging Het
Prdm2 T C 4: 143,132,955 D1255G possibly damaging Het
Prex2 T A 1: 11,162,285 C859S probably damaging Het
Ralgapa2 A T 2: 146,387,629 M1077K possibly damaging Het
Ralgds T C 2: 28,545,520 probably null Het
Rasa3 T C 8: 13,588,865 E314G probably null Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rnf139 A T 15: 58,899,987 L620F probably benign Het
Rptor T A 11: 119,891,163 N1105K probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Sectm1b A T 11: 121,055,934 V45E probably damaging Het
Selenon A G 4: 134,545,657 W157R probably damaging Het
Sema3b C A 9: 107,599,051 R657L possibly damaging Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Sh3tc1 C T 5: 35,706,318 A842T probably damaging Het
Shank2 A G 7: 144,411,829 E1268G probably damaging Het
Shmt1 G A 11: 60,801,465 S155F probably damaging Het
Sim2 A G 16: 94,123,526 E510G possibly damaging Het
Slc25a46 A T 18: 31,600,192 I168N probably damaging Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Slfn14 G T 11: 83,276,658 A677E probably benign Het
Slk G T 19: 47,620,274 Q555H possibly damaging Het
Synj1 A T 16: 90,973,989 D517E probably damaging Het
Syvn1 G A 19: 6,051,474 R440Q probably benign Het
Tas2r118 A T 6: 23,969,468 I198N probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Timeless A G 10: 128,239,956 Y19C possibly damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trmt1l G T 1: 151,457,881 V712F possibly damaging Het
Tti1 T C 2: 158,007,020 probably benign Het
Ulk4 T C 9: 121,141,852 H1018R probably benign Het
Vim A T 2: 13,582,495 H461L probably benign Het
Vmn2r118 T A 17: 55,610,665 E282D probably damaging Het
Vmn2r31 T A 7: 7,384,368 I735F probably damaging Het
Vmn2r88 A G 14: 51,418,793 M829V probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wdr81 T A 11: 75,445,988 E1525V probably damaging Het
Xbp1 A G 11: 5,522,006 D44G probably damaging Het
Zfhx4 T G 3: 5,399,281 F1500V probably damaging Het
Zfp286 A C 11: 62,783,733 Y95* probably null Het
Zfp872 A G 9: 22,199,761 T178A possibly damaging Het
Zkscan5 A G 5: 145,218,830 H364R possibly damaging Het
Zp3r A T 1: 130,577,960 Y422N probably damaging Het
Zscan10 C T 17: 23,610,340 R542C probably benign Het
Other mutations in Wbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Wbp2 APN 11 116081240 missense possibly damaging 0.46
R0006:Wbp2 UTSW 11 116079788 unclassified probably null
R0565:Wbp2 UTSW 11 116082385 missense possibly damaging 0.80
R1510:Wbp2 UTSW 11 116086882 missense probably benign 0.03
R1733:Wbp2 UTSW 11 116083883 missense probably benign 0.10
R1968:Wbp2 UTSW 11 116082365 missense possibly damaging 0.90
R1989:Wbp2 UTSW 11 116080221 critical splice donor site probably null
R2109:Wbp2 UTSW 11 116080619 nonsense probably null
R2264:Wbp2 UTSW 11 116079598 critical splice acceptor site probably null
R3079:Wbp2 UTSW 11 116079708 unclassified probably null
R4239:Wbp2 UTSW 11 116080547 unclassified probably benign
R4831:Wbp2 UTSW 11 116080637 nonsense probably null
R6146:Wbp2 UTSW 11 116083902 missense probably benign 0.07
R6367:Wbp2 UTSW 11 116083915 missense probably benign 0.36
R6455:Wbp2 UTSW 11 116079753 missense probably damaging 0.98
R6823:Wbp2 UTSW 11 116086910 missense probably benign 0.41
Z1088:Wbp2 UTSW 11 116086913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATCTCGGCTAGGAAGTGAGGC -3'
(R):5'- ACACCTGAGTCTGGCTTCTC -3'

Sequencing Primer
(F):5'- CTAGGAAGTGAGGCTTGGAC -3'
(R):5'- CTCCTGGGATGTTTGTTTCCAGC -3'
Posted On2015-10-08