Mutagenetix > Incidental Mutation

Incidental Mutation 'R4647:Adgrv1'

350421

Institutional Source

Beutler Lab

Gene Symbol

Adgrv1

Ensembl Gene

ENSMUSG00000069170

Gene Name

adhesion G protein-coupled receptor V1

Synonyms

Mass1, Mgr1, VLGR1, Gpr98

MMRRC Submission

041908-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4647 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81095068-81633154 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 81528795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1252 (Y1252*)

Ref Sequence

ENSEMBL: ENSMUSP00000105193 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095585] [ENSMUST00000109565]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000095585
AA Change: Y1972*

SMART Domains

Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: Y1972*

Domain	Start	End	E-Value	Type
Calx_beta	20	116	1.53e-1	SMART
Calx_beta	132	236	1.58e-2	SMART
Calx_beta	251	362	2.33e-2	SMART
Pfam:Calx-beta	380	489	1.1e-3	PFAM
Pfam:Calx-beta	507	616	2.5e-2	PFAM
Pfam:Calx-beta	667	747	9.1e-4	PFAM
Calx_beta	764	862	1.55e-1	SMART
Calx_beta	877	980	1.07e-1	SMART
Calx_beta	994	1094	6.45e-5	SMART
Pfam:Calx-beta	1108	1208	7.4e-4	PFAM
Pfam:Laminin_G_3	1331	1492	4.4e-24	PFAM
Pfam:Calx-beta	1498	1542	6.5e-3	PFAM
Pfam:Calx-beta	1557	1662	1e-6	PFAM
Calx_beta	1706	1805	1.34e-11	SMART
Calx_beta	1846	1948	1.04e-2	SMART
Calx_beta	1962	2075	1.59e-3	SMART
Calx_beta	2103	2202	1.59e-4	SMART
Calx_beta	2218	2320	1.74e-3	SMART
Pfam:Calx-beta	2467	2539	2.1e-4	PFAM
Calx_beta	2576	2672	1.24e-6	SMART
Calx_beta	2687	2786	1.12e-1	SMART
Calx_beta	2810	2921	2.21e-2	SMART
Calx_beta	2945	3044	6.69e-12	SMART
Pfam:Calx-beta	3063	3168	1.2e-5	PFAM
Pfam:Calx-beta	3198	3252	1.2e-1	PFAM
Pfam:EPTP	3391	3434	2.8e-10	PFAM
Pfam:Calx-beta	3577	3623	6.5e-8	PFAM
Pfam:Calx-beta	3637	3737	6e-4	PFAM
Pfam:Calx-beta	3781	3872	6.9e-3	PFAM
Calx_beta	3919	4003	1.18e-2	SMART
Calx_beta	4017	4120	5.44e-2	SMART
Pfam:Calx-beta	4193	4236	2.3e-2	PFAM
Calx_beta	4251	4351	1.43e-20	SMART
Calx_beta	4384	4484	9.46e-3	SMART
Pfam:Calx-beta	4498	4608	2e-2	PFAM
Pfam:Calx-beta	4659	4729	5.1e-2	PFAM
Calx_beta	4989	5089	5.7e-6	SMART
Pfam:Calx-beta	5229	5326	1.9e-6	PFAM
Pfam:Calx-beta	5489	5592	7.2e-5	PFAM
low complexity region	5637	5648	N/A	INTRINSIC
GPS	5845	5895	9.48e-3	SMART
Pfam:7tm_2	5902	6141	2.3e-16	PFAM
low complexity region	6227	6240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109565
AA Change: Y1252*

SMART Domains

Protein: ENSMUSP00000105193
Gene: ENSMUSG00000069170
AA Change: Y1252*

Domain	Start	End	E-Value	Type
Calx_beta	44	142	1.55e-1	SMART
Calx_beta	157	260	1.07e-1	SMART
Calx_beta	274	374	6.45e-5	SMART
Pfam:Calx-beta	388	488	4.8e-4	PFAM
Pfam:Laminin_G_3	611	772	3.4e-24	PFAM
Pfam:Calx-beta	778	822	4.4e-3	PFAM
Pfam:Calx-beta	837	942	6.6e-7	PFAM
Calx_beta	986	1085	1.34e-11	SMART
Calx_beta	1126	1228	1.04e-2	SMART
Calx_beta	1242	1355	1.59e-3	SMART
Calx_beta	1383	1482	1.59e-4	SMART
Calx_beta	1498	1600	1.74e-3	SMART
Pfam:Calx-beta	1747	1819	1.4e-4	PFAM
Calx_beta	1856	1952	1.24e-6	SMART
Calx_beta	1967	2066	1.12e-1	SMART
Calx_beta	2090	2201	2.21e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156627

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 139 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700031F05Rik	G	T	X: 102,860,909	N132K	possibly damaging	Het
Aatf	T	C	11: 84,471,197	D313G	possibly damaging	Het
Abcb11	T	G	2: 69,285,271	D583A	probably damaging	Het
Aim2	T	C	1: 173,455,524		silent	Het
Angpt1	T	A	15: 42,676,184	Y93F	probably benign	Het
Ankrd27	C	T	7: 35,638,234	P991L	probably benign	Het
Ap1s3	C	T	1: 79,614,203		probably null	Het
Apbb1	A	C	7: 105,565,538	S500A	probably benign	Het
Arc	G	A	15: 74,671,525	A283V	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
C1galt1c1	A	T	X: 38,631,472	S216T	probably benign	Het
C1qtnf4	T	A	2: 90,889,652	S90T	probably damaging	Het
Cachd1	A	T	4: 100,953,130	K310*	probably null	Het
Calhm1	A	G	19: 47,143,801	L125P	probably damaging	Het
Carmil1	G	A	13: 24,137,179	L278F	probably damaging	Het
Ccar1	A	T	10: 62,747,417	Y972*	probably null	Het
Cd163	C	T	6: 124,320,621	P909S	probably damaging	Het
Cd44	T	A	2: 102,837,929	H268L	possibly damaging	Het
Cdkl2	A	T	5: 92,017,213	L517Q	probably damaging	Het
Cep68	G	T	11: 20,239,349	N554K	probably benign	Het
Ces1d	A	G	8: 93,166,410	W515R	probably damaging	Het
Clca4b	A	C	3: 144,928,525	H102Q	probably benign	Het
Cldn15	T	A	5: 136,974,483	I142N	probably damaging	Het
Cmklr1	T	A	5: 113,614,640	D100V	probably damaging	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
D430041D05Rik	G	A	2: 104,258,443	P63S	probably damaging	Het
Ddx39	A	T	8: 83,722,273	H259L	probably benign	Het
Dhx16	C	G	17: 35,885,635	A565G	probably benign	Het
Dimt1	A	T	13: 106,947,655	D50V	probably benign	Het
Dock9	A	T	14: 121,586,246	L1428H	probably damaging	Het
Dpp4	G	T	2: 62,334,605	T700K	probably damaging	Het
E030030I06Rik	T	A	10: 22,148,845	R56S	unknown	Het
Eea1	A	G	10: 96,028,393	T925A	probably benign	Het
Ext1	A	G	15: 53,089,987	S494P	possibly damaging	Het
Fam171a1	G	A	2: 3,220,291	E140K	probably damaging	Het
Fam19a5	T	G	15: 87,720,582	S115A	probably damaging	Het
Fgfr3	C	T	5: 33,734,986		probably benign	Het
Gabra6	A	G	11: 42,307,372	I407T	probably damaging	Het
Gm13089	T	C	4: 143,699,344	M10V	probably benign	Het
Gm16223	C	A	5: 42,214,611	L115M	unknown	Het
Gm4781	G	T	10: 100,397,000		noncoding transcript	Het
Gm9772	T	A	17: 22,007,032	I70F	possibly damaging	Het
Gpr107	T	A	2: 31,210,501	F497Y	probably damaging	Het
Grm7	T	A	6: 110,914,383	Y192*	probably null	Het
Gtf2ird2	G	A	5: 134,216,192	A431T	probably damaging	Het
H2-K2	T	A	17: 33,976,015		noncoding transcript	Het
H2-M11	T	A	17: 36,547,991	V141D	probably benign	Het
Hmcn1	A	G	1: 150,675,511		probably null	Het
Hmcn2	A	T	2: 31,399,019	Q2280L	possibly damaging	Het
Hmg20b	T	A	10: 81,348,582	Q129L	probably damaging	Het
Igfbp7	T	A	5: 77,351,296	Q285L	possibly damaging	Het
Igkv13-85	T	A	6: 68,930,736		probably benign	Het
Inpp5e	A	T	2: 26,407,914	L225H	probably benign	Het
Inpp5f	T	A	7: 128,659,109	V91E	possibly damaging	Het
Khdc3	A	G	9: 73,102,586	E26G	possibly damaging	Het
Klra5	T	A	6: 129,899,376	D156V	probably damaging	Het
Kmo	C	A	1: 175,659,774	Y430*	probably null	Het
Lbx2	A	G	6: 83,088,046	D188G	probably damaging	Het
Lcorl	A	T	5: 45,733,589	L474*	probably null	Het
Lnx1	C	T	5: 74,610,796	V350I	probably benign	Het
Lrrc45	T	A	11: 120,719,121	S464T	probably benign	Het
Ltc4s	T	A	11: 50,237,225	T61S	probably benign	Het
Luc7l3	A	C	11: 94,309,641	N50K	probably damaging	Het
Ly75	G	A	2: 60,308,278	T1415M	probably damaging	Het
Macf1	T	C	4: 123,473,627	E2447G	probably benign	Het
Map3k21	A	G	8: 125,942,111	D812G	probably benign	Het
Mbtd1	C	T	11: 93,924,611	H342Y	probably damaging	Het
Mest	C	T	6: 30,745,110	R226*	probably null	Het
Mindy1	A	T	3: 95,282,743		probably benign	Het
Mmp13	A	T	9: 7,274,233	D180V	probably damaging	Het
Mn1	A	G	5: 111,420,083	T640A	probably benign	Het
Msi2	T	C	11: 88,718,038	H18R	possibly damaging	Het
Myo18a	T	A	11: 77,817,950	V61E	probably damaging	Het
Myo19	T	G	11: 84,894,642	I237S	probably damaging	Het
Ncaph2	T	A	15: 89,370,432	L416Q	probably damaging	Het
Nlrp1a	T	A	11: 71,097,126		probably null	Het
Olfr1450	A	G	19: 12,954,077	I163V	probably benign	Het
Olfr282	G	T	15: 98,437,576	V36F	probably benign	Het
Olfr353	A	G	2: 36,890,651	F66L	probably benign	Het
Olfr559	A	G	7: 102,724,092	S133P	probably damaging	Het
Olfr710	A	T	7: 106,944,340	N220K	probably benign	Het
Padi2	T	C	4: 140,944,446	F495S	probably damaging	Het
Pan3	G	T	5: 147,527,203	D535Y	probably damaging	Het
Paqr3	T	A	5: 97,108,210	R102*	probably null	Het
Patl1	T	A	19: 11,914,434	D34E	probably damaging	Het
Pcdha6	A	T	18: 36,969,136	T461S	probably damaging	Het
Pcnt	T	C	10: 76,354,213	S2830G	probably benign	Het
Pdgfa	G	A	5: 138,979,184	T181I	probably benign	Het
Pds5a	C	A	5: 65,656,318	D275Y	probably damaging	Het
Plod2	T	A	9: 92,605,450	Y607*	probably null	Het
Pomt2	G	T	12: 87,118,083	T517K	possibly damaging	Het
Prdm1	T	C	10: 44,439,690	T817A	probably damaging	Het
Prdm2	T	C	4: 143,132,955	D1255G	possibly damaging	Het
Prex2	T	A	1: 11,162,285	C859S	probably damaging	Het
Ralgapa2	A	T	2: 146,387,629	M1077K	possibly damaging	Het
Ralgds	T	C	2: 28,545,520		probably null	Het
Rasa3	T	C	8: 13,588,865	E314G	probably null	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rbm46	A	T	3: 82,864,458	D283E	probably benign	Het
Rnf139	A	T	15: 58,899,987	L620F	probably benign	Het
Rptor	T	A	11: 119,891,163	N1105K	probably benign	Het
Scaf11	A	T	15: 96,420,100		probably null	Het
Sectm1b	A	T	11: 121,055,934	V45E	probably damaging	Het
Selenon	A	G	4: 134,545,657	W157R	probably damaging	Het
Sema3b	C	A	9: 107,599,051	R657L	possibly damaging	Het
Setd1b	C	T	5: 123,148,112	A407V	unknown	Het
Sh3tc1	C	T	5: 35,706,318	A842T	probably damaging	Het
Shank2	A	G	7: 144,411,829	E1268G	probably damaging	Het
Shmt1	G	A	11: 60,801,465	S155F	probably damaging	Het
Sim2	A	G	16: 94,123,526	E510G	possibly damaging	Het
Slc25a46	A	T	18: 31,600,192	I168N	probably damaging	Het
Slc26a4	T	G	12: 31,540,526	D376A	possibly damaging	Het
Slfn14	G	T	11: 83,276,658	A677E	probably benign	Het
Slk	G	T	19: 47,620,274	Q555H	possibly damaging	Het
Synj1	A	T	16: 90,973,989	D517E	probably damaging	Het
Syvn1	G	A	19: 6,051,474	R440Q	probably benign	Het
Tas2r118	A	T	6: 23,969,468	I198N	probably damaging	Het
Tdh	A	G	14: 63,493,756	L323P	possibly damaging	Het
Tet2	A	T	3: 133,488,082	M197K	probably benign	Het
Timeless	A	G	10: 128,239,956	Y19C	possibly damaging	Het
Tnn	T	C	1: 160,146,042	M252V	probably benign	Het
Trdn	G	T	10: 33,195,981	E215*	probably null	Het
Trmt1l	G	T	1: 151,457,881	V712F	possibly damaging	Het
Tti1	T	C	2: 158,007,020		probably benign	Het
Ulk4	T	C	9: 121,141,852	H1018R	probably benign	Het
Vim	A	T	2: 13,582,495	H461L	probably benign	Het
Vmn2r118	T	A	17: 55,610,665	E282D	probably damaging	Het
Vmn2r31	T	A	7: 7,384,368	I735F	probably damaging	Het
Vmn2r88	A	G	14: 51,418,793	M829V	probably benign	Het
Washc4	T	A	10: 83,574,543	M665K	possibly damaging	Het
Wbp2	T	A	11: 116,082,381	M67L	probably benign	Het
Wdr81	T	A	11: 75,445,988	E1525V	probably damaging	Het
Xbp1	A	G	11: 5,522,006	D44G	probably damaging	Het
Zfhx4	T	G	3: 5,399,281	F1500V	probably damaging	Het
Zfp286	A	C	11: 62,783,733	Y95*	probably null	Het
Zfp872	A	G	9: 22,199,761	T178A	possibly damaging	Het
Zkscan5	A	G	5: 145,218,830	H364R	possibly damaging	Het
Zp3r	A	T	1: 130,577,960	Y422N	probably damaging	Het
Zscan10	C	T	17: 23,610,340	R542C	probably benign	Het

Other mutations in Adgrv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgrv1	APN	13	81405408	critical splice acceptor site	probably null
IGL00090:Adgrv1	APN	13	81578101	missense	probably damaging	1.00
IGL00091:Adgrv1	APN	13	81578101	missense	probably damaging	1.00
IGL00332:Adgrv1	APN	13	81472877	splice site	probably benign
IGL00471:Adgrv1	APN	13	81509542	missense	probably damaging	0.99
IGL00476:Adgrv1	APN	13	81489074	missense	probably damaging	0.98
IGL00508:Adgrv1	APN	13	81506187	missense	probably damaging	1.00
IGL00727:Adgrv1	APN	13	81524684	missense	probably damaging	0.98
IGL00781:Adgrv1	APN	13	81578230	missense	probably benign	0.19
IGL00816:Adgrv1	APN	13	81397203	missense	probably benign	0.01
IGL00844:Adgrv1	APN	13	81540119	missense	probably damaging	1.00
IGL00923:Adgrv1	APN	13	81382291	missense	probably damaging	0.99
IGL01113:Adgrv1	APN	13	81489028	missense	probably benign	0.00
IGL01143:Adgrv1	APN	13	81419351	missense	probably benign	0.00
IGL01151:Adgrv1	APN	13	81405399	missense	probably benign	0.00
IGL01153:Adgrv1	APN	13	81419128	missense	probably benign	0.01
IGL01363:Adgrv1	APN	13	81557065	missense	probably damaging	1.00
IGL01419:Adgrv1	APN	13	81557158	missense	probably damaging	0.99
IGL01545:Adgrv1	APN	13	81466184	missense	possibly damaging	0.46
IGL01701:Adgrv1	APN	13	81419631	missense	possibly damaging	0.55
IGL01796:Adgrv1	APN	13	81567342	missense	probably benign	0.01
IGL01816:Adgrv1	APN	13	81529049	missense	probably benign	0.00
IGL01871:Adgrv1	APN	13	81472394	critical splice donor site	probably null
IGL01955:Adgrv1	APN	13	81182783	missense	probably damaging	1.00
IGL01956:Adgrv1	APN	13	81446430	missense	possibly damaging	0.63
IGL01988:Adgrv1	APN	13	81557309	missense	probably damaging	0.99
IGL01990:Adgrv1	APN	13	81556996	missense	probably damaging	1.00
IGL02007:Adgrv1	APN	13	81568743	splice site	probably benign
IGL02016:Adgrv1	APN	13	81397453	missense	probably damaging	1.00
IGL02095:Adgrv1	APN	13	81579790	missense	possibly damaging	0.63
IGL02174:Adgrv1	APN	13	81427664	missense	probably benign	0.34
IGL02270:Adgrv1	APN	13	81559195	splice site	probably null
IGL02328:Adgrv1	APN	13	81578175	missense	probably damaging	1.00
IGL02350:Adgrv1	APN	13	81270855	missense	probably benign	0.00
IGL02357:Adgrv1	APN	13	81270855	missense	probably benign	0.00
IGL02373:Adgrv1	APN	13	81459713	missense	possibly damaging	0.90
IGL02402:Adgrv1	APN	13	81559424	missense	probably benign	0.18
IGL02407:Adgrv1	APN	13	81479670	missense	probably damaging	1.00
IGL02508:Adgrv1	APN	13	81435556	splice site	probably benign
IGL02603:Adgrv1	APN	13	81488952	missense	possibly damaging	0.93
IGL02648:Adgrv1	APN	13	81511619	missense	probably benign	0.35
IGL02720:Adgrv1	APN	13	81578872	missense	probably damaging	0.99
IGL02870:Adgrv1	APN	13	81563732	missense	probably benign	0.13
IGL02896:Adgrv1	APN	13	81520739	missense	probably damaging	1.00
IGL02931:Adgrv1	APN	13	81579714	missense	probably damaging	1.00
IGL02952:Adgrv1	APN	13	81433636	missense	probably benign	0.00
IGL02961:Adgrv1	APN	13	81523612	missense	probably damaging	1.00
IGL02999:Adgrv1	APN	13	81578854	missense	probably benign	0.12
IGL03067:Adgrv1	APN	13	81442480	missense	probably damaging	1.00
IGL03106:Adgrv1	APN	13	81472899	missense	probably benign	0.00
IGL03108:Adgrv1	APN	13	81559529	missense	probably damaging	1.00
IGL03119:Adgrv1	APN	13	81382373	missense	probably damaging	1.00
IGL03119:Adgrv1	APN	13	81433700	missense	probably benign	0.02
IGL03169:Adgrv1	APN	13	81503900	missense	probably damaging	1.00
IGL03186:Adgrv1	APN	13	81433618	missense	possibly damaging	0.80
IGL03196:Adgrv1	APN	13	81446478	missense	probably benign	0.02
IGL03207:Adgrv1	APN	13	81106898	splice site	probably null
IGL03343:Adgrv1	APN	13	81283388	missense	probably damaging	1.00
IGL03348:Adgrv1	APN	13	81499058	missense	possibly damaging	0.54
IGL03349:Adgrv1	APN	13	81481336	missense	probably benign	0.09
IGL03373:Adgrv1	APN	13	81563632	missense	probably damaging	0.99
IGL03381:Adgrv1	APN	13	81517967	missense	probably damaging	0.99
abetting	UTSW	13	81579560	missense	probably damaging	1.00
beatle	UTSW	13	81579594	nonsense	probably null
Escape	UTSW	13	81435705	missense	probably benign	0.02
lento	UTSW	13	81270897	missense	probably damaging	1.00
Metronome	UTSW	13	81435559	critical splice donor site	probably null
Murderous	UTSW	13	81103324	missense	possibly damaging	0.94
Nome	UTSW	13	81391767	missense	probably benign	0.00
Propulsion	UTSW	13	81475047	missense	probably benign	0.06
revulsion	UTSW	13	81595182	missense	probably damaging	1.00
Saturnv	UTSW	13	81531676	missense	probably damaging	1.00
Thrust	UTSW	13	81374256	missense	probably benign	0.01
Velocity	UTSW	13	81397354	missense	probably benign	0.00
Wilting	UTSW	13	81492501	missense	probably benign	0.02
Withering	UTSW	13	81494657	missense	probably damaging	1.00
F2404:Adgrv1	UTSW	13	81420006	missense	probably benign	0.13
G1patch:Adgrv1	UTSW	13	81437557	missense	probably damaging	0.99
G1patch:Adgrv1	UTSW	13	81493210	missense	probably damaging	1.00
I2288:Adgrv1	UTSW	13	81437524	missense	probably damaging	1.00
I2289:Adgrv1	UTSW	13	81437524	missense	probably damaging	1.00
PIT4377001:Adgrv1	UTSW	13	81528985	missense	probably damaging	1.00
PIT4504001:Adgrv1	UTSW	13	81559352	missense	probably damaging	0.99
R0017:Adgrv1	UTSW	13	81578946	missense	probably benign	0.13
R0017:Adgrv1	UTSW	13	81578946	missense	probably benign	0.13
R0058:Adgrv1	UTSW	13	81182672	missense	possibly damaging	0.65
R0058:Adgrv1	UTSW	13	81182672	missense	possibly damaging	0.65
R0083:Adgrv1	UTSW	13	81578404	unclassified	probably benign
R0087:Adgrv1	UTSW	13	81386951	missense	probably damaging	1.00
R0108:Adgrv1	UTSW	13	81578404	unclassified	probably benign
R0131:Adgrv1	UTSW	13	81502995	unclassified	probably benign
R0218:Adgrv1	UTSW	13	81106898	splice site	probably null
R0325:Adgrv1	UTSW	13	81540015	missense	probably damaging	1.00
R0326:Adgrv1	UTSW	13	81474993	missense	possibly damaging	0.46
R0395:Adgrv1	UTSW	13	81385953	missense	probably benign	0.00
R0441:Adgrv1	UTSW	13	81397226	nonsense	probably null
R0466:Adgrv1	UTSW	13	81566296	missense	probably benign	0.00
R0487:Adgrv1	UTSW	13	81489035	missense	probably damaging	1.00
R0501:Adgrv1	UTSW	13	81559150	missense	probably damaging	1.00
R0522:Adgrv1	UTSW	13	81528442	splice site	probably benign
R0532:Adgrv1	UTSW	13	81578896	missense	probably damaging	1.00
R0542:Adgrv1	UTSW	13	81573318	missense	probably damaging	1.00
R0681:Adgrv1	UTSW	13	81528530	missense	probably damaging	1.00
R0689:Adgrv1	UTSW	13	81475105	missense	possibly damaging	0.47
R0732:Adgrv1	UTSW	13	81503004	missense	possibly damaging	0.86
R0746:Adgrv1	UTSW	13	81570556	missense	probably benign	0.10
R0763:Adgrv1	UTSW	13	81499125	missense	probably damaging	0.98
R0846:Adgrv1	UTSW	13	81479742	nonsense	probably null
R0962:Adgrv1	UTSW	13	81405346	missense	probably benign	0.01
R1146:Adgrv1	UTSW	13	81531676	missense	probably damaging	1.00
R1146:Adgrv1	UTSW	13	81531676	missense	probably damaging	1.00
R1172:Adgrv1	UTSW	13	81557063	missense	probably damaging	0.98
R1178:Adgrv1	UTSW	13	81440037	splice site	probably benign
R1310:Adgrv1	UTSW	13	81566377	missense	probably benign	0.09
R1386:Adgrv1	UTSW	13	81528865	missense	probably benign	0.17
R1387:Adgrv1	UTSW	13	81493176	missense	possibly damaging	0.62
R1395:Adgrv1	UTSW	13	81386788	missense	probably benign	0.05
R1412:Adgrv1	UTSW	13	81095450	missense	probably damaging	1.00
R1448:Adgrv1	UTSW	13	81433513	missense	probably benign	0.08
R1470:Adgrv1	UTSW	13	81382298	missense	probably benign	0.03
R1470:Adgrv1	UTSW	13	81382298	missense	probably benign	0.03
R1485:Adgrv1	UTSW	13	81579619	missense	probably damaging	1.00
R1507:Adgrv1	UTSW	13	81472580	critical splice acceptor site	probably null
R1513:Adgrv1	UTSW	13	81556957	missense	probably damaging	1.00
R1513:Adgrv1	UTSW	13	81593048	missense	probably damaging	1.00
R1539:Adgrv1	UTSW	13	81503978	splice site	probably null
R1579:Adgrv1	UTSW	13	81563779	missense	probably damaging	1.00
R1580:Adgrv1	UTSW	13	81466160	critical splice donor site	probably null
R1611:Adgrv1	UTSW	13	81559117	missense	probably damaging	1.00
R1615:Adgrv1	UTSW	13	81424288	missense	probably benign	0.41
R1651:Adgrv1	UTSW	13	81487853	missense	probably benign	0.19
R1660:Adgrv1	UTSW	13	81476631	missense	probably benign	0.00
R1679:Adgrv1	UTSW	13	81559552	missense	probably damaging	1.00
R1709:Adgrv1	UTSW	13	81593060	missense	probably damaging	1.00
R1735:Adgrv1	UTSW	13	81487947	missense	possibly damaging	0.62
R1762:Adgrv1	UTSW	13	81506146	missense	probably benign	0.08
R1830:Adgrv1	UTSW	13	81489077	missense	possibly damaging	0.65
R1836:Adgrv1	UTSW	13	81504113	missense	probably benign	0.01
R1843:Adgrv1	UTSW	13	81544533	missense	probably damaging	1.00
R1863:Adgrv1	UTSW	13	81563566	missense	probably damaging	1.00
R1895:Adgrv1	UTSW	13	81374249	missense	probably damaging	1.00
R1907:Adgrv1	UTSW	13	81592551	splice site	probably benign
R1928:Adgrv1	UTSW	13	81520786	missense	probably benign	0.00
R1938:Adgrv1	UTSW	13	81391757	missense	probably damaging	0.99
R1944:Adgrv1	UTSW	13	81510911	missense	probably damaging	1.00
R1946:Adgrv1	UTSW	13	81374249	missense	probably damaging	1.00
R1984:Adgrv1	UTSW	13	81523749	missense	probably damaging	1.00
R2027:Adgrv1	UTSW	13	81595182	missense	probably damaging	1.00
R2063:Adgrv1	UTSW	13	81561469	missense	possibly damaging	0.81
R2116:Adgrv1	UTSW	13	81529013	missense	probably benign	0.11
R2117:Adgrv1	UTSW	13	81492537	missense	probably benign	0.00
R2125:Adgrv1	UTSW	13	81419535	missense	probably benign	0.00
R2125:Adgrv1	UTSW	13	81419950	missense	probably benign	0.02
R2127:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2128:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2129:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2130:Adgrv1	UTSW	13	81581727	missense	possibly damaging	0.61
R2135:Adgrv1	UTSW	13	81524557	critical splice donor site	probably null
R2138:Adgrv1	UTSW	13	81445320	missense	probably benign	0.00
R2166:Adgrv1	UTSW	13	81568643	missense	probably damaging	1.00
R2171:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R2191:Adgrv1	UTSW	13	81566290	missense	possibly damaging	0.90
R2256:Adgrv1	UTSW	13	81506140	missense	probably benign
R2260:Adgrv1	UTSW	13	81568374	missense	probably damaging	0.97
R2323:Adgrv1	UTSW	13	81595179	missense	probably damaging	1.00
R2432:Adgrv1	UTSW	13	81540132	frame shift	probably null
R2910:Adgrv1	UTSW	13	81557119	missense	possibly damaging	0.61
R2920:Adgrv1	UTSW	13	81448865	missense	probably benign	0.01
R2989:Adgrv1	UTSW	13	81581747	missense	probably damaging	1.00
R3402:Adgrv1	UTSW	13	81543542	missense	probably damaging	1.00
R3692:Adgrv1	UTSW	13	81524600	missense	possibly damaging	0.91
R3711:Adgrv1	UTSW	13	81419475	missense	probably benign	0.02
R3732:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3732:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3733:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3773:Adgrv1	UTSW	13	81499043	missense	probably damaging	0.98
R3791:Adgrv1	UTSW	13	81593102	missense	probably damaging	1.00
R3794:Adgrv1	UTSW	13	81283367	start codon destroyed	probably damaging	1.00
R3848:Adgrv1	UTSW	13	81440072	missense	probably damaging	0.97
R3880:Adgrv1	UTSW	13	81435705	missense	probably benign	0.02
R3925:Adgrv1	UTSW	13	81578772	missense	possibly damaging	0.89
R3934:Adgrv1	UTSW	13	81475047	missense	probably benign	0.06
R3942:Adgrv1	UTSW	13	81182789	missense	probably damaging	1.00
R4002:Adgrv1	UTSW	13	81540132	frame shift	probably null
R4003:Adgrv1	UTSW	13	81540132	frame shift	probably null
R4194:Adgrv1	UTSW	13	81498996	missense	probably damaging	0.98
R4308:Adgrv1	UTSW	13	81440192	missense	probably damaging	0.96
R4368:Adgrv1	UTSW	13	81492910	missense	unknown
R4388:Adgrv1	UTSW	13	81581709	missense	probably damaging	0.98
R4421:Adgrv1	UTSW	13	81566302	missense	probably damaging	1.00
R4468:Adgrv1	UTSW	13	81374256	missense	probably benign	0.01
R4483:Adgrv1	UTSW	13	81419230	missense	probably benign	0.01
R4487:Adgrv1	UTSW	13	81440066	missense	probably damaging	0.99
R4566:Adgrv1	UTSW	13	81419808	missense	probably damaging	1.00
R4615:Adgrv1	UTSW	13	81494569	splice site	probably null
R4657:Adgrv1	UTSW	13	81405364	missense	probably benign	0.01
R4723:Adgrv1	UTSW	13	81433525	missense	probably benign	0.02
R4765:Adgrv1	UTSW	13	81106919	missense	probably damaging	0.99
R4783:Adgrv1	UTSW	13	81095445	missense	probably damaging	0.99
R4796:Adgrv1	UTSW	13	81155231	nonsense	probably null
R4816:Adgrv1	UTSW	13	81528674	missense	probably damaging	1.00
R4833:Adgrv1	UTSW	13	81560844	missense	possibly damaging	0.81
R4841:Adgrv1	UTSW	13	81503001	critical splice donor site	probably null
R4871:Adgrv1	UTSW	13	81533122	intron	probably benign
R4897:Adgrv1	UTSW	13	81561585	splice site	probably null
R4906:Adgrv1	UTSW	13	81270738	splice site	probably null
R4917:Adgrv1	UTSW	13	81510877	missense	probably benign	0.30
R4996:Adgrv1	UTSW	13	81578734	missense	probably benign	0.01
R5030:Adgrv1	UTSW	13	81459829	missense	probably benign	0.43
R5044:Adgrv1	UTSW	13	81488931	missense	probably benign	0.01
R5052:Adgrv1	UTSW	13	81528821	missense	probably damaging	0.97
R5093:Adgrv1	UTSW	13	81592585	missense	probably damaging	1.00
R5095:Adgrv1	UTSW	13	81095487	missense	probably benign	0.00
R5119:Adgrv1	UTSW	13	81419427	missense	possibly damaging	0.93
R5133:Adgrv1	UTSW	13	81439441	missense	probably damaging	1.00
R5141:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R5164:Adgrv1	UTSW	13	81435674	missense	probably benign	0.00
R5180:Adgrv1	UTSW	13	81283416	start gained	probably benign
R5203:Adgrv1	UTSW	13	81510905	missense	possibly damaging	0.91
R5241:Adgrv1	UTSW	13	81488929	nonsense	probably null
R5280:Adgrv1	UTSW	13	81397465	missense	possibly damaging	0.95
R5289:Adgrv1	UTSW	13	81521084	missense	probably benign	0.04
R5304:Adgrv1	UTSW	13	81578253	missense	possibly damaging	0.93
R5310:Adgrv1	UTSW	13	81476690	missense	possibly damaging	0.95
R5338:Adgrv1	UTSW	13	81529046	missense	possibly damaging	0.80
R5352:Adgrv1	UTSW	13	81494657	missense	probably damaging	1.00
R5402:Adgrv1	UTSW	13	81459715	missense	probably benign	0.25
R5418:Adgrv1	UTSW	13	81419308	missense	probably benign	0.01
R5460:Adgrv1	UTSW	13	81424258	missense	possibly damaging	0.95
R5510:Adgrv1	UTSW	13	81445244	missense	probably damaging	1.00
R5521:Adgrv1	UTSW	13	81419389	missense	probably benign	0.01
R5538:Adgrv1	UTSW	13	81433689	missense	probably benign	0.02
R5561:Adgrv1	UTSW	13	81476564	missense	probably damaging	0.99
R5584:Adgrv1	UTSW	13	81405267	missense	probably damaging	1.00
R5608:Adgrv1	UTSW	13	81155276	missense	probably damaging	1.00
R5610:Adgrv1	UTSW	13	81521117	missense	probably damaging	1.00
R5619:Adgrv1	UTSW	13	81472500	missense	probably damaging	1.00
R5751:Adgrv1	UTSW	13	81522236	missense	probably damaging	1.00
R5832:Adgrv1	UTSW	13	81103302	missense	possibly damaging	0.95
R5885:Adgrv1	UTSW	13	81424271	missense	probably benign	0.15
R5930:Adgrv1	UTSW	13	81397451	missense	probably benign	0.06
R5937:Adgrv1	UTSW	13	81107075	missense	probably damaging	0.96
R5943:Adgrv1	UTSW	13	81386866	missense	probably damaging	0.98
R5951:Adgrv1	UTSW	13	81442501	missense	probably damaging	1.00
R5977:Adgrv1	UTSW	13	81435559	critical splice donor site	probably null
R5995:Adgrv1	UTSW	13	81466259	missense	probably benign	0.03
R6017:Adgrv1	UTSW	13	81397423	nonsense	probably null
R6024:Adgrv1	UTSW	13	81476505	missense	probably benign	0.26
R6049:Adgrv1	UTSW	13	81397354	missense	probably benign	0.00
R6108:Adgrv1	UTSW	13	81391695	missense	probably damaging	0.99
R6130:Adgrv1	UTSW	13	81427745	missense	probably damaging	0.99
R6132:Adgrv1	UTSW	13	81506076	missense	probably benign	0.04
R6149:Adgrv1	UTSW	13	81182774	missense	probably damaging	1.00
R6169:Adgrv1	UTSW	13	81419259	missense	probably benign	0.00
R6175:Adgrv1	UTSW	13	81386005	missense	probably damaging	1.00
R6184:Adgrv1	UTSW	13	81433838	missense	probably benign	0.01
R6190:Adgrv1	UTSW	13	81459763	splice site	probably null
R6190:Adgrv1	UTSW	13	81524779	splice site	probably null
R6215:Adgrv1	UTSW	13	81579594	nonsense	probably null
R6216:Adgrv1	UTSW	13	81524471	splice site	probably null
R6238:Adgrv1	UTSW	13	81466283	missense	probably benign	0.07
R6244:Adgrv1	UTSW	13	81106931	missense	probably damaging	1.00
R6298:Adgrv1	UTSW	13	81391767	missense	probably benign	0.00
R6316:Adgrv1	UTSW	13	81499068	missense	possibly damaging	0.63
R6336:Adgrv1	UTSW	13	81385981	missense	probably benign	0.09
R6358:Adgrv1	UTSW	13	81414583	missense	probably damaging	0.99
R6421:Adgrv1	UTSW	13	81508736	missense	possibly damaging	0.69
R6466:Adgrv1	UTSW	13	81575101	splice site	probably null
R6467:Adgrv1	UTSW	13	81444538	missense	probably benign	0.01
R6510:Adgrv1	UTSW	13	81559490	missense	possibly damaging	0.88
R6519:Adgrv1	UTSW	13	81567343	missense	probably benign	0.01
R6521:Adgrv1	UTSW	13	81433652	missense	probably damaging	1.00
R6598:Adgrv1	UTSW	13	81506179	missense	probably damaging	1.00
R6605:Adgrv1	UTSW	13	81487962	missense	possibly damaging	0.80
R6626:Adgrv1	UTSW	13	81518126	missense	probably damaging	1.00
R6633:Adgrv1	UTSW	13	81568643	missense	probably damaging	1.00
R6721:Adgrv1	UTSW	13	81481515	missense	probably benign	0.00
R6725:Adgrv1	UTSW	13	81437557	missense	probably damaging	0.99
R6725:Adgrv1	UTSW	13	81493210	missense	probably damaging	1.00
R6796:Adgrv1	UTSW	13	81472478	missense	probably damaging	1.00
R6809:Adgrv1	UTSW	13	81472953	missense	probably benign	0.01
R6823:Adgrv1	UTSW	13	81557081	missense	probably damaging	1.00
R6876:Adgrv1	UTSW	13	81155154	critical splice donor site	probably null
R6878:Adgrv1	UTSW	13	81433494	missense	probably benign	0.06
R6887:Adgrv1	UTSW	13	81528701	missense	probably benign	0.01
R6888:Adgrv1	UTSW	13	81508669	missense	probably damaging	1.00
R6957:Adgrv1	UTSW	13	81567490	missense	probably benign	0.00
R6976:Adgrv1	UTSW	13	81520997	missense	probably damaging	1.00
R7003:Adgrv1	UTSW	13	81522104	critical splice donor site	probably null
R7007:Adgrv1	UTSW	13	81536364	missense	possibly damaging	0.80
R7073:Adgrv1	UTSW	13	81561474	missense	probably damaging	1.00
R7100:Adgrv1	UTSW	13	81270897	missense	probably damaging	1.00
R7107:Adgrv1	UTSW	13	81578142	missense	probably benign	0.13
R7123:Adgrv1	UTSW	13	81592574	missense	probably damaging	1.00
R7141:Adgrv1	UTSW	13	81492501	missense	probably benign	0.02
R7168:Adgrv1	UTSW	13	81397209	missense	possibly damaging	0.52
R7205:Adgrv1	UTSW	13	81479658	missense	probably benign	0.00
R7239:Adgrv1	UTSW	13	81476612	missense	possibly damaging	0.69
R7249:Adgrv1	UTSW	13	81374259	missense	probably damaging	1.00
R7313:Adgrv1	UTSW	13	81520515	missense	possibly damaging	0.95
R7376:Adgrv1	UTSW	13	81518126	missense	probably damaging	1.00
R7392:Adgrv1	UTSW	13	81560689	missense	probably damaging	1.00
R7395:Adgrv1	UTSW	13	81559348	missense	probably damaging	1.00
R7410:Adgrv1	UTSW	13	81563619	missense	probably benign	0.04
R7449:Adgrv1	UTSW	13	81499073	missense	probably damaging	0.99
R7496:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7497:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7498:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7567:Adgrv1	UTSW	13	81433529	missense	probably benign	0.00
R7567:Adgrv1	UTSW	13	81579477	missense	probably damaging	1.00
R7614:Adgrv1	UTSW	13	81520661	missense	probably damaging	1.00
R7623:Adgrv1	UTSW	13	81422225	missense	possibly damaging	0.77
R7665:Adgrv1	UTSW	13	81499142	missense	probably damaging	1.00
R7685:Adgrv1	UTSW	13	81103324	missense	possibly damaging	0.94
R7788:Adgrv1	UTSW	13	81573314	missense	probably damaging	1.00
R7809:Adgrv1	UTSW	13	81528641	missense	possibly damaging	0.81
R7854:Adgrv1	UTSW	13	81593088	missense	probably damaging	1.00
R7894:Adgrv1	UTSW	13	81567451	missense	probably benign	0.00
R7948:Adgrv1	UTSW	13	81559529	missense	probably damaging	1.00
R7948:Adgrv1	UTSW	13	81559588	missense	probably damaging	1.00
R7949:Adgrv1	UTSW	13	81155234	missense	probably damaging	1.00
R7951:Adgrv1	UTSW	13	81563570	missense	probably damaging	1.00
R7968:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7969:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7973:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8007:Adgrv1	UTSW	13	81283466	missense	probably benign	0.04
R8018:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8044:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8050:Adgrv1	UTSW	13	81413177	missense	probably damaging	1.00
R8090:Adgrv1	UTSW	13	81448834	critical splice donor site	probably null
R8104:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8122:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R8122:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8123:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8125:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8126:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8212:Adgrv1	UTSW	13	81522121	missense	probably benign	0.01
R8221:Adgrv1	UTSW	13	81528914	missense	probably benign	0.00
R8256:Adgrv1	UTSW	13	81579560	missense	probably damaging	1.00
R8270:Adgrv1	UTSW	13	81503044	missense	probably damaging	0.96
R8290:Adgrv1	UTSW	13	81481883	missense	probably benign	0.00
R8298:Adgrv1	UTSW	13	81385914	nonsense	probably null
R8317:Adgrv1	UTSW	13	81575117	missense	probably damaging	0.98
R8326:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8327:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8330:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8332:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8345:Adgrv1	UTSW	13	81103386	missense	probably damaging	1.00
R8398:Adgrv1	UTSW	13	81182678	missense	probably damaging	1.00
R8399:Adgrv1	UTSW	13	81489170	missense	possibly damaging	0.55
R8450:Adgrv1	UTSW	13	81435843	splice site	probably null
R8471:Adgrv1	UTSW	13	81446472	missense	probably benign	0.00
R8534:Adgrv1	UTSW	13	81386768	missense	probably benign	0.02
R8537:Adgrv1	UTSW	13	81536372	missense	probably damaging	1.00
R8703:Adgrv1	UTSW	13	81528673	missense	probably damaging	1.00
R8845:Adgrv1	UTSW	13	81481359	missense	possibly damaging	0.79
R8846:Adgrv1	UTSW	13	81488906	critical splice donor site	probably null
R8849:Adgrv1	UTSW	13	81521205	missense	probably benign
R8856:Adgrv1	UTSW	13	81559502	missense	probably benign	0.11
R8915:Adgrv1	UTSW	13	81567439	missense	probably damaging	1.00
R8963:Adgrv1	UTSW	13	81419469	missense	probably benign
R8994:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8995:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8996:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8997:Adgrv1	UTSW	13	81405338	frame shift	probably null
R9022:Adgrv1	UTSW	13	81155193	missense	probably damaging	1.00
R9059:Adgrv1	UTSW	13	81414573	critical splice donor site	probably null
R9076:Adgrv1	UTSW	13	81422128	critical splice donor site	probably null
R9119:Adgrv1	UTSW	13	81510876	missense	probably damaging	0.97
R9137:Adgrv1	UTSW	13	81540014	missense	probably damaging	1.00
R9146:Adgrv1	UTSW	13	81413172	missense	probably benign	0.11
R9156:Adgrv1	UTSW	13	81521183	missense	probably benign	0.00
R9163:Adgrv1	UTSW	13	81419422	missense	probably benign	0.19
R9282:Adgrv1	UTSW	13	81103372	missense	probably damaging	1.00
R9286:Adgrv1	UTSW	13	81446401	missense	probably damaging	0.98
R9328:Adgrv1	UTSW	13	81472404	missense	probably damaging	1.00
R9329:Adgrv1	UTSW	13	81499122	missense	probably damaging	1.00
R9350:Adgrv1	UTSW	13	81506155	missense	probably damaging	1.00
R9377:Adgrv1	UTSW	13	81557158	missense	probably damaging	0.99
R9394:Adgrv1	UTSW	13	81476648	missense	possibly damaging	0.95
R9419:Adgrv1	UTSW	13	81508768	missense	probably benign	0.44
R9427:Adgrv1	UTSW	13	81584115	missense	probably benign	0.00
R9429:Adgrv1	UTSW	13	81419349	missense	probably damaging	1.00
R9429:Adgrv1	UTSW	13	81593046	missense	probably damaging	0.99
R9433:Adgrv1	UTSW	13	81566352	missense	probably benign	0.02
R9434:Adgrv1	UTSW	13	81518173	splice site	probably benign
R9513:Adgrv1	UTSW	13	81382353	missense	possibly damaging	0.95
R9515:Adgrv1	UTSW	13	81543378	missense	probably damaging	0.99
R9523:Adgrv1	UTSW	13	81419059	missense
R9525:Adgrv1	UTSW	13	81445334	missense	possibly damaging	0.77
R9576:Adgrv1	UTSW	13	81543489	missense	probably benign	0.06
R9612:Adgrv1	UTSW	13	81492963	missense	probably damaging	1.00
R9664:Adgrv1	UTSW	13	81522169	missense	probably benign	0.01
R9664:Adgrv1	UTSW	13	81595252	missense	probably damaging	1.00
R9702:Adgrv1	UTSW	13	81536364	missense	possibly damaging	0.80
R9717:Adgrv1	UTSW	13	81520781	missense	probably damaging	1.00
R9720:Adgrv1	UTSW	13	81592574	missense	probably damaging	1.00
X0054:Adgrv1	UTSW	13	81559270	missense	probably damaging	1.00
X0062:Adgrv1	UTSW	13	81386926	missense	probably damaging	0.99
X0067:Adgrv1	UTSW	13	81543392	missense	possibly damaging	0.51
Z1088:Adgrv1	UTSW	13	81476672	missense	probably damaging	1.00
Z1176:Adgrv1	UTSW	13	81559634	missense	possibly damaging	0.90
Z1177:Adgrv1	UTSW	13	81419256	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TGCCTCAGTCTGATTAGCTCTG -3'
(R):5'- CACATTTGAGACTGGGCAGAG -3'

Sequencing Primer
(F):5'- GCCTCAGTCTGATTAGCTCTGAAAAG -3'
(R):5'- ACTGGGCAGAGGATTGCTTCC -3'

Posted On

2015-10-08