Incidental Mutation 'R4647:Dock9'
ID 350425
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 041908-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4647 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121823658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1428 (L1428H)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: L1427H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: L1427H

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: L1398H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: L1398H

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211907
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: L1428H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212371
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: L1418H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212719
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
Aatf T C 11: 84,362,023 (GRCm39) D313G possibly damaging Het
Abcb11 T G 2: 69,115,615 (GRCm39) D583A probably damaging Het
Adgrv1 A T 13: 81,676,914 (GRCm39) Y1252* probably null Het
Aim2 T C 1: 173,283,090 (GRCm39) silent Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd27 C T 7: 35,337,659 (GRCm39) P991L probably benign Het
Ap1s3 C T 1: 79,591,920 (GRCm39) probably null Het
Apbb1 A C 7: 105,214,745 (GRCm39) S500A probably benign Het
Arc G A 15: 74,543,374 (GRCm39) A283V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
C1qtnf4 T A 2: 90,719,996 (GRCm39) S90T probably damaging Het
Cachd1 A T 4: 100,810,327 (GRCm39) K310* probably null Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Carmil1 G A 13: 24,321,162 (GRCm39) L278F probably damaging Het
Ccar1 A T 10: 62,583,196 (GRCm39) Y972* probably null Het
Cd163 C T 6: 124,297,580 (GRCm39) P909S probably damaging Het
Cd44 T A 2: 102,668,274 (GRCm39) H268L possibly damaging Het
Cdkl2 A T 5: 92,165,072 (GRCm39) L517Q probably damaging Het
Cep68 G T 11: 20,189,349 (GRCm39) N554K probably benign Het
Ces1d A G 8: 93,893,038 (GRCm39) W515R probably damaging Het
Clca4b A C 3: 144,634,286 (GRCm39) H102Q probably benign Het
Cldn15 T A 5: 137,003,337 (GRCm39) I142N probably damaging Het
Cmklr1 T A 5: 113,752,701 (GRCm39) D100V probably damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
D430041D05Rik G A 2: 104,088,788 (GRCm39) P63S probably damaging Het
Ddx39a A T 8: 84,448,902 (GRCm39) H259L probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dimt1 A T 13: 107,084,163 (GRCm39) D50V probably benign Het
Dpp4 G T 2: 62,164,949 (GRCm39) T700K probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Eea1 A G 10: 95,864,255 (GRCm39) T925A probably benign Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Fam171a1 G A 2: 3,221,328 (GRCm39) E140K probably damaging Het
Fgfr3 C T 5: 33,892,330 (GRCm39) probably benign Het
Gabra6 A G 11: 42,198,199 (GRCm39) I407T probably damaging Het
Gm16223 C A 5: 42,371,954 (GRCm39) L115M unknown Het
Gm4781 G T 10: 100,232,862 (GRCm39) noncoding transcript Het
Gm9772 T A 17: 22,226,013 (GRCm39) I70F possibly damaging Het
Gpr107 T A 2: 31,100,513 (GRCm39) F497Y probably damaging Het
Grm7 T A 6: 110,891,344 (GRCm39) Y192* probably null Het
Gtf2ird2 G A 5: 134,245,034 (GRCm39) A431T probably damaging Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
H2-M11 T A 17: 36,858,883 (GRCm39) V141D probably benign Het
Hmcn1 A G 1: 150,551,262 (GRCm39) probably null Het
Hmcn2 A T 2: 31,289,031 (GRCm39) Q2280L possibly damaging Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Igfbp7 T A 5: 77,499,143 (GRCm39) Q285L possibly damaging Het
Igkv13-85 T A 6: 68,907,720 (GRCm39) probably benign Het
Inpp5e A T 2: 26,297,926 (GRCm39) L225H probably benign Het
Inpp5f T A 7: 128,260,833 (GRCm39) V91E possibly damaging Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Klra5 T A 6: 129,876,339 (GRCm39) D156V probably damaging Het
Kmo C A 1: 175,487,340 (GRCm39) Y430* probably null Het
Lbx2 A G 6: 83,065,027 (GRCm39) D188G probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lrrc45 T A 11: 120,609,947 (GRCm39) S464T probably benign Het
Ltc4s T A 11: 50,128,052 (GRCm39) T61S probably benign Het
Luc7l3 A C 11: 94,200,467 (GRCm39) N50K probably damaging Het
Ly75 G A 2: 60,138,622 (GRCm39) T1415M probably damaging Het
Macf1 T C 4: 123,367,420 (GRCm39) E2447G probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mbtd1 C T 11: 93,815,437 (GRCm39) H342Y probably damaging Het
Mest C T 6: 30,745,109 (GRCm39) R226* probably null Het
Mindy1 A T 3: 95,190,054 (GRCm39) probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mn1 A G 5: 111,567,949 (GRCm39) T640A probably benign Het
Msi2 T C 11: 88,608,864 (GRCm39) H18R possibly damaging Het
Myo18a T A 11: 77,708,776 (GRCm39) V61E probably damaging Het
Myo19 T G 11: 84,785,468 (GRCm39) I237S probably damaging Het
Ncaph2 T A 15: 89,254,635 (GRCm39) L416Q probably damaging Het
Nlrp1a T A 11: 70,987,952 (GRCm39) probably null Het
Or1n1b A G 2: 36,780,663 (GRCm39) F66L probably benign Het
Or2d4 A T 7: 106,543,547 (GRCm39) N220K probably benign Het
Or51a25 A G 7: 102,373,299 (GRCm39) S133P probably damaging Het
Or5b98 A G 19: 12,931,441 (GRCm39) I163V probably benign Het
Or8s10 G T 15: 98,335,457 (GRCm39) V36F probably benign Het
Padi2 T C 4: 140,671,757 (GRCm39) F495S probably damaging Het
Pan3 G T 5: 147,464,013 (GRCm39) D535Y probably damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl1 T A 19: 11,891,798 (GRCm39) D34E probably damaging Het
Pcdha6 A T 18: 37,102,189 (GRCm39) T461S probably damaging Het
Pcnt T C 10: 76,190,047 (GRCm39) S2830G probably benign Het
Pdgfa G A 5: 138,964,939 (GRCm39) T181I probably benign Het
Pds5a C A 5: 65,813,661 (GRCm39) D275Y probably damaging Het
Plod2 T A 9: 92,487,503 (GRCm39) Y607* probably null Het
Pomt2 G T 12: 87,164,857 (GRCm39) T517K possibly damaging Het
Pramel23 T C 4: 143,425,914 (GRCm39) M10V probably benign Het
Prdm1 T C 10: 44,315,686 (GRCm39) T817A probably damaging Het
Prdm2 T C 4: 142,859,525 (GRCm39) D1255G possibly damaging Het
Prex2 T A 1: 11,232,509 (GRCm39) C859S probably damaging Het
Ralgapa2 A T 2: 146,229,549 (GRCm39) M1077K possibly damaging Het
Ralgds T C 2: 28,435,532 (GRCm39) probably null Het
Rasa3 T C 8: 13,638,865 (GRCm39) E314G probably null Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rnf139 A T 15: 58,771,836 (GRCm39) L620F probably benign Het
Rptor T A 11: 119,781,989 (GRCm39) N1105K probably benign Het
Scaf11 A T 15: 96,317,981 (GRCm39) probably null Het
Sectm1b A T 11: 120,946,760 (GRCm39) V45E probably damaging Het
Selenon A G 4: 134,272,968 (GRCm39) W157R probably damaging Het
Sema3b C A 9: 107,476,250 (GRCm39) R657L possibly damaging Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Sh3tc1 C T 5: 35,863,662 (GRCm39) A842T probably damaging Het
Shank2 A G 7: 143,965,566 (GRCm39) E1268G probably damaging Het
Shmt1 G A 11: 60,692,291 (GRCm39) S155F probably damaging Het
Sim2 A G 16: 93,924,385 (GRCm39) E510G possibly damaging Het
Slc25a46 A T 18: 31,733,245 (GRCm39) I168N probably damaging Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Slfn14 G T 11: 83,167,484 (GRCm39) A677E probably benign Het
Slk G T 19: 47,608,713 (GRCm39) Q555H possibly damaging Het
Synj1 A T 16: 90,770,877 (GRCm39) D517E probably damaging Het
Syvn1 G A 19: 6,101,504 (GRCm39) R440Q probably benign Het
Tafa5 T G 15: 87,604,783 (GRCm39) S115A probably damaging Het
Tas2r118 A T 6: 23,969,467 (GRCm39) I198N probably damaging Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Timeless A G 10: 128,075,825 (GRCm39) Y19C possibly damaging Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trmt1l G T 1: 151,333,632 (GRCm39) V712F possibly damaging Het
Tti1 T C 2: 157,848,940 (GRCm39) probably benign Het
Ulk4 T C 9: 120,970,918 (GRCm39) H1018R probably benign Het
Vim A T 2: 13,587,306 (GRCm39) H461L probably benign Het
Vmn2r118 T A 17: 55,917,665 (GRCm39) E282D probably damaging Het
Vmn2r31 T A 7: 7,387,367 (GRCm39) I735F probably damaging Het
Vmn2r88 A G 14: 51,656,250 (GRCm39) M829V probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Wbp2 T A 11: 115,973,207 (GRCm39) M67L probably benign Het
Wdr81 T A 11: 75,336,814 (GRCm39) E1525V probably damaging Het
Xbp1 A G 11: 5,472,006 (GRCm39) D44G probably damaging Het
Zfhx4 T G 3: 5,464,341 (GRCm39) F1500V probably damaging Het
Zfp286 A C 11: 62,674,559 (GRCm39) Y95* probably null Het
Zfp872 A G 9: 22,111,057 (GRCm39) T178A possibly damaging Het
Zkscan5 A G 5: 145,155,640 (GRCm39) H364R possibly damaging Het
Zp3r A T 1: 130,505,697 (GRCm39) Y422N probably damaging Het
Zscan10 C T 17: 23,829,314 (GRCm39) R542C probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTTACACTCACGACG -3'
(R):5'- GTTGACTGTTACTGCCGCAC -3'

Sequencing Primer
(F):5'- TTCTTACACTCACGACGGGAATG -3'
(R):5'- GTTACTGCCGCACCCCAC -3'
Posted On 2015-10-08