Incidental Mutation 'R4647:Sim2'
ID350435
Institutional Source Beutler Lab
Gene Symbol Sim2
Ensembl Gene ENSMUSG00000062713
Gene Namesingle-minded family bHLH transcription factor 2
SynonymsbHLHe15
MMRRC Submission 041908-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4647 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94084931-94127032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94123526 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 510 (E510G)
Ref Sequence ENSEMBL: ENSMUSP00000072043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000231688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072182
AA Change: E510G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713
AA Change: E510G

DomainStartEndE-ValueType
HLH 6 58 6.99e-5 SMART
PAS 79 145 7.8e-13 SMART
PAS 220 286 1.31e-5 SMART
PAC 292 335 2.44e-5 SMART
Pfam:SIM_C 358 650 4.5e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231295
Predicted Effect probably benign
Transcript: ENSMUST00000231688
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, cleft palate, malformed pterygoid processes, and aerophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
Aatf T C 11: 84,471,197 D313G possibly damaging Het
Abcb11 T G 2: 69,285,271 D583A probably damaging Het
Adgrv1 A T 13: 81,528,795 Y1252* probably null Het
Aim2 T C 1: 173,455,524 silent Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd27 C T 7: 35,638,234 P991L probably benign Het
Ap1s3 C T 1: 79,614,203 probably null Het
Apbb1 A C 7: 105,565,538 S500A probably benign Het
Arc G A 15: 74,671,525 A283V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C1qtnf4 T A 2: 90,889,652 S90T probably damaging Het
Cachd1 A T 4: 100,953,130 K310* probably null Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Carmil1 G A 13: 24,137,179 L278F probably damaging Het
Ccar1 A T 10: 62,747,417 Y972* probably null Het
Cd163 C T 6: 124,320,621 P909S probably damaging Het
Cd44 T A 2: 102,837,929 H268L possibly damaging Het
Cdkl2 A T 5: 92,017,213 L517Q probably damaging Het
Cep68 G T 11: 20,239,349 N554K probably benign Het
Ces1d A G 8: 93,166,410 W515R probably damaging Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cldn15 T A 5: 136,974,483 I142N probably damaging Het
Cmklr1 T A 5: 113,614,640 D100V probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
D430041D05Rik G A 2: 104,258,443 P63S probably damaging Het
Ddx39 A T 8: 83,722,273 H259L probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dimt1 A T 13: 106,947,655 D50V probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dpp4 G T 2: 62,334,605 T700K probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Eea1 A G 10: 96,028,393 T925A probably benign Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Fam171a1 G A 2: 3,220,291 E140K probably damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fgfr3 C T 5: 33,734,986 probably benign Het
Gabra6 A G 11: 42,307,372 I407T probably damaging Het
Gm13089 T C 4: 143,699,344 M10V probably benign Het
Gm16223 C A 5: 42,214,611 L115M unknown Het
Gm4781 G T 10: 100,397,000 noncoding transcript Het
Gm9772 T A 17: 22,007,032 I70F possibly damaging Het
Gpr107 T A 2: 31,210,501 F497Y probably damaging Het
Grm7 T A 6: 110,914,383 Y192* probably null Het
Gtf2ird2 G A 5: 134,216,192 A431T probably damaging Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
H2-M11 T A 17: 36,547,991 V141D probably benign Het
Hmcn1 A G 1: 150,675,511 probably null Het
Hmcn2 A T 2: 31,399,019 Q2280L possibly damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Igfbp7 T A 5: 77,351,296 Q285L possibly damaging Het
Igkv13-85 T A 6: 68,930,736 probably benign Het
Inpp5e A T 2: 26,407,914 L225H probably benign Het
Inpp5f T A 7: 128,659,109 V91E possibly damaging Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Klra5 T A 6: 129,899,376 D156V probably damaging Het
Kmo C A 1: 175,659,774 Y430* probably null Het
Lbx2 A G 6: 83,088,046 D188G probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lrrc45 T A 11: 120,719,121 S464T probably benign Het
Ltc4s T A 11: 50,237,225 T61S probably benign Het
Luc7l3 A C 11: 94,309,641 N50K probably damaging Het
Ly75 G A 2: 60,308,278 T1415M probably damaging Het
Macf1 T C 4: 123,473,627 E2447G probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mbtd1 C T 11: 93,924,611 H342Y probably damaging Het
Mest C T 6: 30,745,110 R226* probably null Het
Mindy1 A T 3: 95,282,743 probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mn1 A G 5: 111,420,083 T640A probably benign Het
Msi2 T C 11: 88,718,038 H18R possibly damaging Het
Myo18a T A 11: 77,817,950 V61E probably damaging Het
Myo19 T G 11: 84,894,642 I237S probably damaging Het
Ncaph2 T A 15: 89,370,432 L416Q probably damaging Het
Nlrp1a T A 11: 71,097,126 probably null Het
Olfr1450 A G 19: 12,954,077 I163V probably benign Het
Olfr282 G T 15: 98,437,576 V36F probably benign Het
Olfr353 A G 2: 36,890,651 F66L probably benign Het
Olfr559 A G 7: 102,724,092 S133P probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Padi2 T C 4: 140,944,446 F495S probably damaging Het
Pan3 G T 5: 147,527,203 D535Y probably damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl1 T A 19: 11,914,434 D34E probably damaging Het
Pcdha6 A T 18: 36,969,136 T461S probably damaging Het
Pcnt T C 10: 76,354,213 S2830G probably benign Het
Pdgfa G A 5: 138,979,184 T181I probably benign Het
Pds5a C A 5: 65,656,318 D275Y probably damaging Het
Plod2 T A 9: 92,605,450 Y607* probably null Het
Pomt2 G T 12: 87,118,083 T517K possibly damaging Het
Prdm1 T C 10: 44,439,690 T817A probably damaging Het
Prdm2 T C 4: 143,132,955 D1255G possibly damaging Het
Prex2 T A 1: 11,162,285 C859S probably damaging Het
Ralgapa2 A T 2: 146,387,629 M1077K possibly damaging Het
Ralgds T C 2: 28,545,520 probably null Het
Rasa3 T C 8: 13,588,865 E314G probably null Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rnf139 A T 15: 58,899,987 L620F probably benign Het
Rptor T A 11: 119,891,163 N1105K probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Sectm1b A T 11: 121,055,934 V45E probably damaging Het
Selenon A G 4: 134,545,657 W157R probably damaging Het
Sema3b C A 9: 107,599,051 R657L possibly damaging Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Sh3tc1 C T 5: 35,706,318 A842T probably damaging Het
Shank2 A G 7: 144,411,829 E1268G probably damaging Het
Shmt1 G A 11: 60,801,465 S155F probably damaging Het
Slc25a46 A T 18: 31,600,192 I168N probably damaging Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Slfn14 G T 11: 83,276,658 A677E probably benign Het
Slk G T 19: 47,620,274 Q555H possibly damaging Het
Synj1 A T 16: 90,973,989 D517E probably damaging Het
Syvn1 G A 19: 6,051,474 R440Q probably benign Het
Tas2r118 A T 6: 23,969,468 I198N probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Timeless A G 10: 128,239,956 Y19C possibly damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trmt1l G T 1: 151,457,881 V712F possibly damaging Het
Tti1 T C 2: 158,007,020 probably benign Het
Ulk4 T C 9: 121,141,852 H1018R probably benign Het
Vim A T 2: 13,582,495 H461L probably benign Het
Vmn2r118 T A 17: 55,610,665 E282D probably damaging Het
Vmn2r31 T A 7: 7,384,368 I735F probably damaging Het
Vmn2r88 A G 14: 51,418,793 M829V probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp2 T A 11: 116,082,381 M67L probably benign Het
Wdr81 T A 11: 75,445,988 E1525V probably damaging Het
Xbp1 A G 11: 5,522,006 D44G probably damaging Het
Zfhx4 T G 3: 5,399,281 F1500V probably damaging Het
Zfp286 A C 11: 62,783,733 Y95* probably null Het
Zfp872 A G 9: 22,199,761 T178A possibly damaging Het
Zkscan5 A G 5: 145,218,830 H364R possibly damaging Het
Zp3r A T 1: 130,577,960 Y422N probably damaging Het
Zscan10 C T 17: 23,610,340 R542C probably benign Het
Other mutations in Sim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sim2 APN 16 94114944 nonsense probably null
IGL01329:Sim2 APN 16 94106260 missense possibly damaging 0.64
IGL01965:Sim2 APN 16 94121178 missense probably benign 0.20
IGL01979:Sim2 APN 16 94123482 missense possibly damaging 0.81
IGL02821:Sim2 APN 16 94097188 missense probably damaging 1.00
IGL03027:Sim2 APN 16 94109492 splice site probably benign
P0027:Sim2 UTSW 16 94109422 missense probably benign 0.02
PIT4696001:Sim2 UTSW 16 94094309 missense possibly damaging 0.49
R1836:Sim2 UTSW 16 94123577 critical splice donor site probably null
R2034:Sim2 UTSW 16 94085942 missense probably damaging 0.96
R4085:Sim2 UTSW 16 94109354 missense possibly damaging 0.48
R4475:Sim2 UTSW 16 94125791 missense probably benign
R4476:Sim2 UTSW 16 94125791 missense probably benign
R4919:Sim2 UTSW 16 94109335 missense probably benign 0.01
R4966:Sim2 UTSW 16 94123421 missense probably benign 0.03
R5320:Sim2 UTSW 16 94104739 missense probably benign 0.01
R5555:Sim2 UTSW 16 94109456 missense probably damaging 1.00
R5591:Sim2 UTSW 16 94097189 missense probably damaging 1.00
R5870:Sim2 UTSW 16 94123334 missense probably damaging 0.99
R6020:Sim2 UTSW 16 94097251 missense probably damaging 1.00
R6302:Sim2 UTSW 16 94097230 missense probably damaging 1.00
R6883:Sim2 UTSW 16 94125536 missense probably benign 0.00
R7170:Sim2 UTSW 16 94122700 missense probably benign 0.00
R7559:Sim2 UTSW 16 94109359 missense possibly damaging 0.95
R7740:Sim2 UTSW 16 94114960 missense probably benign 0.25
T0722:Sim2 UTSW 16 94109422 missense probably benign 0.02
X0063:Sim2 UTSW 16 94122698 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGACACTTCCCATTGGACTCTC -3'
(R):5'- CCATGAAACCATGATGGGCAG -3'

Sequencing Primer
(F):5'- GGACTCTCACGTCTTCAGCAG -3'
(R):5'- TAGGAAGCACAGAAATCCCAGCTTAG -3'
Posted On2015-10-08