Incidental Mutation 'R4648:Vil1'
ID 350452
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Name villin 1
Synonyms
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.312) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74409376-74435559 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74432298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 746 (M746T)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366] [ENSMUST00000044260]
AlphaFold Q62468
Predicted Effect probably benign
Transcript: ENSMUST00000027366
AA Change: M746T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: M746T

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044260
SMART Domains Protein: ENSMUSP00000035445
Gene: ENSMUSG00000033364

DomainStartEndE-ValueType
Pfam:UCH_N 1 105 5.1e-47 PFAM
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 645 3.4e-16 PFAM
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 F352L probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 splice site probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74421383 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74427558 missense probably benign 0.00
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R3939:Vil1 UTSW 1 74432415 missense probably benign 0.09
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7320:Vil1 UTSW 1 74418444 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R7791:Vil1 UTSW 1 74428136 missense probably damaging 1.00
R8159:Vil1 UTSW 1 74423977 missense probably benign 0.00
R8190:Vil1 UTSW 1 74434893 nonsense probably null
R9650:Vil1 UTSW 1 74425616 missense probably benign 0.32
R9679:Vil1 UTSW 1 74430674 missense probably benign 0.00
R9734:Vil1 UTSW 1 74415150 missense possibly damaging 0.46
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGACTTAGGCCAGTTGC -3'
(R):5'- ATGGACCAGACCTTGTCCTG -3'

Sequencing Primer
(F):5'- CTAGGCTATTAGCTTTTGGGTCCAAC -3'
(R):5'- AGACCTTGTCCTGCTTGTG -3'
Posted On 2015-10-08