Incidental Mutation 'R4648:Otof'
ID 350474
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Name otoferlin
Synonyms
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30367062-30461932 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30383570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 875 (E875G)
Ref Sequence ENSEMBL: ENSMUSP00000073803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000074171
AA Change: E875G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: E875G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114747
AA Change: E890G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: E890G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133509
AA Change: E890G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: E890G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 (GRCm38) N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 (GRCm38) Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 (GRCm38) S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 (GRCm38) Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 (GRCm38) F352L probably damaging Het
Angpt1 T A 15: 42,676,184 (GRCm38) Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 (GRCm38) *129W probably null Het
Atp5j T C 16: 84,828,455 (GRCm38) M87V probably benign Het
Atp8b3 A G 10: 80,525,623 (GRCm38) S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 (GRCm38) K703E probably benign Het
Bbs2 A T 8: 94,080,879 (GRCm38) V429E probably damaging Het
Bccip C T 7: 133,714,899 (GRCm38) L83F probably damaging Het
Brd9 G A 13: 73,940,776 (GRCm38) V198I probably benign Het
C1galt1c1 A T X: 38,631,472 (GRCm38) S216T probably benign Het
C77080 G T 4: 129,221,940 (GRCm38) T977K probably benign Het
Calhm1 A G 19: 47,143,801 (GRCm38) L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 (GRCm38) Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 (GRCm38) L343F probably benign Het
Cep350 A G 1: 155,902,598 (GRCm38) S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 (GRCm38) I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 (GRCm38) L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 (GRCm38) V24M possibly damaging Het
Crp A G 1: 172,698,137 (GRCm38) M1V probably null Het
Csmd1 G A 8: 15,998,788 (GRCm38) Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 (GRCm38) I74F probably benign Het
Dab1 C T 4: 104,731,751 (GRCm38) A524V probably benign Het
Dcaf1 A T 9: 106,865,677 (GRCm38) probably benign Het
Dhx16 C G 17: 35,885,635 (GRCm38) A565G probably benign Het
Dock7 C A 4: 98,969,644 (GRCm38) E1448* probably null Het
Dpf2 C T 19: 5,907,081 (GRCm38) R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 (GRCm38) R56S unknown Het
Etnk1 A G 6: 143,195,274 (GRCm38) Y248C probably damaging Het
Ext1 A G 15: 53,089,987 (GRCm38) S494P possibly damaging Het
Gk2 T C 5: 97,455,720 (GRCm38) S420G probably benign Het
Gm26596 T C 10: 112,929,159 (GRCm38) probably benign Het
Gm5414 G T 15: 101,628,108 (GRCm38) N27K possibly damaging Het
Gskip A G 12: 105,698,729 (GRCm38) D9G probably benign Het
H2-K2 T A 17: 33,976,015 (GRCm38) noncoding transcript Het
Hk1 T G 10: 62,304,779 (GRCm38) S105R probably benign Het
Hmg20b T A 10: 81,348,582 (GRCm38) Q129L probably damaging Het
Idnk A G 13: 58,162,869 (GRCm38) D67G probably benign Het
Igfbp5 G T 1: 72,864,063 (GRCm38) H118N probably benign Het
Irf4 A T 13: 30,763,597 (GRCm38) Y427F probably benign Het
Khdc3 A G 9: 73,102,586 (GRCm38) E26G possibly damaging Het
Kif7 T C 7: 79,709,191 (GRCm38) D512G probably damaging Het
Lamb3 T A 1: 193,331,357 (GRCm38) I513N probably damaging Het
Lipo1 A G 19: 33,783,460 (GRCm38) L174P probably damaging Het
Lnx1 C T 5: 74,610,796 (GRCm38) V350I probably benign Het
Map3k21 A G 8: 125,942,111 (GRCm38) D812G probably benign Het
Mast2 G T 4: 116,314,839 (GRCm38) Y637* probably null Het
Matn2 T C 15: 34,428,533 (GRCm38) I681T probably damaging Het
Med18 A T 4: 132,462,963 (GRCm38) V37D possibly damaging Het
Mip T A 10: 128,227,053 (GRCm38) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm38) D180V probably damaging Het
Mpg C A 11: 32,230,034 (GRCm38) C187* probably null Het
Mtmr14 A G 6: 113,260,606 (GRCm38) E256G probably benign Het
Myo7b C T 18: 31,967,125 (GRCm38) probably null Het
Nmt1 T A 11: 103,063,917 (GRCm38) V425D probably damaging Het
Nynrin T A 14: 55,872,894 (GRCm38) Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 (GRCm38) F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 (GRCm38) N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 (GRCm38) V227A possibly damaging Het
Paqr3 T A 5: 97,108,210 (GRCm38) R102* probably null Het
Phc1 T C 6: 122,321,913 (GRCm38) I699V possibly damaging Het
Prkdc T G 16: 15,816,774 (GRCm38) D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 (GRCm38) D246V probably damaging Het
Rbm46 A T 3: 82,864,458 (GRCm38) D283E probably benign Het
Ror2 A T 13: 53,285,500 (GRCm38) C9* probably null Het
Setd1b C T 5: 123,148,112 (GRCm38) A407V unknown Het
Slc26a4 T G 12: 31,540,526 (GRCm38) D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 (GRCm38) E215G probably benign Het
Spag16 G A 1: 69,827,035 (GRCm38) R11Q probably null Het
Sult1d1 T A 5: 87,566,095 (GRCm38) Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 (GRCm38) C746R probably benign Het
Tdh A G 14: 63,493,756 (GRCm38) L323P possibly damaging Het
Tet2 A T 3: 133,488,082 (GRCm38) M197K probably benign Het
Tnn T C 1: 160,146,042 (GRCm38) M252V probably benign Het
Trdn G T 10: 33,195,981 (GRCm38) E215* probably null Het
Trem1 G A 17: 48,244,562 (GRCm38) V84I probably benign Het
Tspan5 T C 3: 138,898,315 (GRCm38) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm38) R647G probably benign Het
Usp50 T A 2: 126,778,033 (GRCm38) I120F probably damaging Het
Vil1 T C 1: 74,432,298 (GRCm38) M746T probably benign Het
Washc4 T A 10: 83,574,543 (GRCm38) M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 (GRCm38) T681A probably benign Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30,375,904 (GRCm38) missense probably damaging 1.00
IGL00391:Otof APN 5 30,375,623 (GRCm38) missense probably damaging 1.00
IGL00579:Otof APN 5 30,399,322 (GRCm38) missense possibly damaging 0.88
IGL00671:Otof APN 5 30,385,753 (GRCm38) critical splice donor site probably null
IGL01019:Otof APN 5 30,405,216 (GRCm38) missense probably benign 0.01
IGL01025:Otof APN 5 30,384,253 (GRCm38) missense possibly damaging 0.82
IGL01086:Otof APN 5 30,376,273 (GRCm38) critical splice donor site probably null
IGL01110:Otof APN 5 30,461,725 (GRCm38) missense probably damaging 1.00
IGL01160:Otof APN 5 30,381,535 (GRCm38) missense probably benign 0.00
IGL01285:Otof APN 5 30,405,183 (GRCm38) missense probably damaging 1.00
IGL01329:Otof APN 5 30,441,379 (GRCm38) missense probably benign 0.00
IGL01337:Otof APN 5 30,419,512 (GRCm38) missense probably benign 0.17
IGL01337:Otof APN 5 30,405,777 (GRCm38) missense possibly damaging 0.93
IGL01834:Otof APN 5 30,399,220 (GRCm38) missense probably damaging 1.00
IGL01872:Otof APN 5 30,379,254 (GRCm38) splice site probably benign
IGL01969:Otof APN 5 30,382,483 (GRCm38) splice site probably benign
IGL02075:Otof APN 5 30,370,726 (GRCm38) missense probably benign 0.23
IGL02077:Otof APN 5 30,399,235 (GRCm38) missense probably damaging 1.00
IGL02136:Otof APN 5 30,373,992 (GRCm38) missense possibly damaging 0.90
IGL02227:Otof APN 5 30,370,784 (GRCm38) missense probably damaging 1.00
IGL02475:Otof APN 5 30,376,682 (GRCm38) missense probably damaging 1.00
IGL02812:Otof APN 5 30,374,082 (GRCm38) missense probably benign 0.08
IGL02864:Otof APN 5 30,386,341 (GRCm38) missense probably damaging 0.99
IGL03176:Otof APN 5 30,405,176 (GRCm38) splice site probably null
R0285:Otof UTSW 5 30,379,533 (GRCm38) critical splice donor site probably null
R0421:Otof UTSW 5 30,371,568 (GRCm38) missense possibly damaging 0.94
R0570:Otof UTSW 5 30,371,881 (GRCm38) splice site probably benign
R0599:Otof UTSW 5 30,370,705 (GRCm38) missense probably damaging 1.00
R0675:Otof UTSW 5 30,382,361 (GRCm38) missense probably benign 0.01
R0715:Otof UTSW 5 30,394,697 (GRCm38) missense probably damaging 0.99
R1019:Otof UTSW 5 30,370,743 (GRCm38) missense probably damaging 0.96
R1183:Otof UTSW 5 30,371,912 (GRCm38) missense probably damaging 1.00
R1435:Otof UTSW 5 30,378,695 (GRCm38) missense probably benign 0.00
R1469:Otof UTSW 5 30,380,227 (GRCm38) missense probably benign 0.00
R1469:Otof UTSW 5 30,380,227 (GRCm38) missense probably benign 0.00
R1474:Otof UTSW 5 30,379,532 (GRCm38) critical splice donor site probably null
R1524:Otof UTSW 5 30,379,556 (GRCm38) missense probably benign 0.03
R1563:Otof UTSW 5 30,371,005 (GRCm38) missense probably benign 0.00
R1732:Otof UTSW 5 30,386,471 (GRCm38) missense probably damaging 1.00
R1822:Otof UTSW 5 30,378,710 (GRCm38) missense probably benign 0.00
R1845:Otof UTSW 5 30,371,723 (GRCm38) nonsense probably null
R1925:Otof UTSW 5 30,394,188 (GRCm38) missense probably benign 0.37
R1938:Otof UTSW 5 30,376,369 (GRCm38) missense probably benign 0.00
R1968:Otof UTSW 5 30,388,654 (GRCm38) missense probably damaging 1.00
R1996:Otof UTSW 5 30,421,037 (GRCm38) missense probably benign 0.01
R1999:Otof UTSW 5 30,388,772 (GRCm38) missense probably benign 0.19
R2027:Otof UTSW 5 30,421,014 (GRCm38) missense probably benign 0.08
R2138:Otof UTSW 5 30,461,770 (GRCm38) missense probably benign 0.01
R2173:Otof UTSW 5 30,386,374 (GRCm38) missense probably damaging 1.00
R2245:Otof UTSW 5 30,370,207 (GRCm38) missense probably damaging 1.00
R3011:Otof UTSW 5 30,382,840 (GRCm38) missense probably damaging 1.00
R3105:Otof UTSW 5 30,381,801 (GRCm38) missense probably benign 0.03
R3442:Otof UTSW 5 30,371,689 (GRCm38) missense probably damaging 1.00
R3710:Otof UTSW 5 30,385,266 (GRCm38) missense probably benign
R3715:Otof UTSW 5 30,376,871 (GRCm38) nonsense probably null
R3806:Otof UTSW 5 30,386,499 (GRCm38) critical splice acceptor site probably null
R3975:Otof UTSW 5 30,370,712 (GRCm38) missense probably damaging 1.00
R4067:Otof UTSW 5 30,399,291 (GRCm38) missense probably damaging 1.00
R4077:Otof UTSW 5 30,419,506 (GRCm38) missense possibly damaging 0.89
R4166:Otof UTSW 5 30,382,418 (GRCm38) missense probably damaging 1.00
R4451:Otof UTSW 5 30,385,164 (GRCm38) missense possibly damaging 0.77
R4485:Otof UTSW 5 30,375,000 (GRCm38) missense possibly damaging 0.77
R4600:Otof UTSW 5 30,371,900 (GRCm38) missense probably damaging 1.00
R4646:Otof UTSW 5 30,383,570 (GRCm38) missense possibly damaging 0.82
R4669:Otof UTSW 5 30,420,974 (GRCm38) critical splice donor site probably null
R4773:Otof UTSW 5 30,394,682 (GRCm38) missense probably benign 0.05
R4839:Otof UTSW 5 30,419,404 (GRCm38) missense probably damaging 0.99
R4907:Otof UTSW 5 30,378,661 (GRCm38) critical splice donor site probably null
R4961:Otof UTSW 5 30,383,493 (GRCm38) intron probably benign
R4991:Otof UTSW 5 30,394,181 (GRCm38) missense probably damaging 1.00
R5015:Otof UTSW 5 30,382,894 (GRCm38) missense probably damaging 1.00
R5036:Otof UTSW 5 30,384,439 (GRCm38) missense possibly damaging 0.54
R5038:Otof UTSW 5 30,384,439 (GRCm38) missense possibly damaging 0.54
R5253:Otof UTSW 5 30,370,139 (GRCm38) missense probably damaging 1.00
R5336:Otof UTSW 5 30,376,720 (GRCm38) missense probably benign 0.01
R5365:Otof UTSW 5 30,381,800 (GRCm38) missense probably damaging 0.99
R5901:Otof UTSW 5 30,374,979 (GRCm38) missense probably damaging 1.00
R6211:Otof UTSW 5 30,371,900 (GRCm38) missense probably damaging 0.99
R6318:Otof UTSW 5 30,414,544 (GRCm38) missense probably damaging 1.00
R6331:Otof UTSW 5 30,371,935 (GRCm38) missense possibly damaging 0.94
R6671:Otof UTSW 5 30,419,533 (GRCm38) missense probably benign
R6701:Otof UTSW 5 30,370,797 (GRCm38) nonsense probably null
R6792:Otof UTSW 5 30,375,634 (GRCm38) missense probably damaging 1.00
R6853:Otof UTSW 5 30,388,239 (GRCm38) missense probably damaging 1.00
R6940:Otof UTSW 5 30,371,643 (GRCm38) missense probably damaging 0.96
R7037:Otof UTSW 5 30,381,538 (GRCm38) missense probably benign 0.32
R7060:Otof UTSW 5 30,388,356 (GRCm38) missense possibly damaging 0.84
R7089:Otof UTSW 5 30,371,568 (GRCm38) missense possibly damaging 0.94
R7165:Otof UTSW 5 30,375,620 (GRCm38) missense probably damaging 0.99
R7178:Otof UTSW 5 30,383,534 (GRCm38) missense possibly damaging 0.50
R7298:Otof UTSW 5 30,388,270 (GRCm38) missense probably damaging 1.00
R7393:Otof UTSW 5 30,370,270 (GRCm38) missense probably benign 0.45
R7397:Otof UTSW 5 30,375,707 (GRCm38) missense probably damaging 1.00
R7400:Otof UTSW 5 30,385,188 (GRCm38) missense probably benign 0.04
R7428:Otof UTSW 5 30,389,825 (GRCm38) missense probably damaging 1.00
R7456:Otof UTSW 5 30,394,661 (GRCm38) missense probably damaging 1.00
R7505:Otof UTSW 5 30,371,020 (GRCm38) missense probably benign 0.00
R7714:Otof UTSW 5 30,370,253 (GRCm38) missense probably damaging 0.99
R8002:Otof UTSW 5 30,380,610 (GRCm38) missense probably benign 0.10
R8032:Otof UTSW 5 30,461,798 (GRCm38) start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30,388,735 (GRCm38) missense probably damaging 1.00
R8158:Otof UTSW 5 30,380,194 (GRCm38) missense probably benign 0.37
R8159:Otof UTSW 5 30,380,194 (GRCm38) missense probably benign 0.37
R8441:Otof UTSW 5 30,380,856 (GRCm38) missense probably damaging 0.99
R8738:Otof UTSW 5 30,388,624 (GRCm38) nonsense probably null
R8813:Otof UTSW 5 30,382,898 (GRCm38) missense probably benign 0.02
R8835:Otof UTSW 5 30,370,920 (GRCm38) missense probably benign 0.44
R8852:Otof UTSW 5 30,371,700 (GRCm38) missense possibly damaging 0.94
R8869:Otof UTSW 5 30,420,981 (GRCm38) missense probably benign 0.08
R9029:Otof UTSW 5 30,370,075 (GRCm38) critical splice donor site probably null
R9031:Otof UTSW 5 30,380,188 (GRCm38) missense probably benign
R9061:Otof UTSW 5 30,388,657 (GRCm38) missense possibly damaging 0.50
R9100:Otof UTSW 5 30,382,352 (GRCm38) missense possibly damaging 0.80
R9121:Otof UTSW 5 30,379,118 (GRCm38) missense probably benign 0.04
R9188:Otof UTSW 5 30,376,751 (GRCm38) missense probably damaging 1.00
R9218:Otof UTSW 5 30,385,125 (GRCm38) missense probably benign
R9280:Otof UTSW 5 30,371,550 (GRCm38) missense probably damaging 0.98
R9395:Otof UTSW 5 30,375,632 (GRCm38) missense probably damaging 1.00
R9400:Otof UTSW 5 30,383,519 (GRCm38) critical splice donor site probably null
R9407:Otof UTSW 5 30,380,921 (GRCm38) missense probably damaging 1.00
R9616:Otof UTSW 5 30,382,364 (GRCm38) missense possibly damaging 0.95
R9665:Otof UTSW 5 30,427,551 (GRCm38) missense probably benign 0.22
R9748:Otof UTSW 5 30,383,654 (GRCm38) missense probably damaging 1.00
R9783:Otof UTSW 5 30,379,232 (GRCm38) missense probably benign
Z1176:Otof UTSW 5 30,371,586 (GRCm38) missense probably damaging 0.98
Z1177:Otof UTSW 5 30,383,658 (GRCm38) missense probably damaging 1.00
Z1177:Otof UTSW 5 30,376,297 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAGATAGAGCTTCACCTACCC -3'
(R):5'- TTTTCCTCAGCTAGGCCCAG -3'

Sequencing Primer
(F):5'- CACCGGACAGAGCTGGGTATG -3'
(R):5'- TCCCAGGAGTGAGGTTCAG -3'
Posted On 2015-10-08