Mutagenetix > Incidental Mutation

Incidental Mutation 'R4648:Otof'

350474

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

041909-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R4648 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30383570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 875 (E875G)

Ref Sequence

ENSEMBL: ENSMUSP00000073803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074171
AA Change: E875G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: E875G

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114747
AA Change: E890G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: E890G

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133509
AA Change: E890G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: E890G

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.4e-2	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700031F05Rik	G	T	X: 102,860,909	N132K	possibly damaging	Het
2010315B03Rik	T	A	9: 124,293,598	Y232F	probably benign	Het
2310079G19Rik	T	C	16: 88,627,367	S79G	probably benign	Het
4930568D16Rik	T	A	2: 35,354,446	Y298F	probably damaging	Het
Alpk2	A	G	18: 65,349,882	F352L	probably damaging	Het
Angpt1	T	A	15: 42,676,184	Y93F	probably benign	Het
Ankrd33b	T	C	15: 31,325,024	*129W	probably null	Het
Atp5j	T	C	16: 84,828,455	M87V	probably benign	Het
Atp8b3	A	G	10: 80,525,623	S822P	possibly damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bbs2	A	T	8: 94,080,879	V429E	probably damaging	Het
Bccip	C	T	7: 133,714,899	L83F	probably damaging	Het
Brd9	G	A	13: 73,940,776	V198I	probably benign	Het
C1galt1c1	A	T	X: 38,631,472	S216T	probably benign	Het
C77080	G	T	4: 129,221,940	T977K	probably benign	Het
Calhm1	A	G	19: 47,143,801	L125P	probably damaging	Het
Ccdc110	A	T	8: 45,942,668	Q532L	possibly damaging	Het
Cdh19	G	A	1: 110,925,177	L343F	probably benign	Het
Cep350	A	G	1: 155,902,598	S1653P	possibly damaging	Het
Cmtm4	A	G	8: 104,356,320	I135T	possibly damaging	Het
Cmya5	A	G	13: 93,093,828	L1584P	possibly damaging	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
Crp	A	G	1: 172,698,137	M1V	probably null	Het
Csmd1	G	A	8: 15,998,788	Q2305*	probably null	Het
Cyp2c38	T	A	19: 39,460,688	I74F	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dcaf1	A	T	9: 106,865,677		probably benign	Het
Dhx16	C	G	17: 35,885,635	A565G	probably benign	Het
Dock7	C	A	4: 98,969,644	E1448*	probably null	Het
Dpf2	C	T	19: 5,907,081	R38H	probably damaging	Het
E030030I06Rik	T	A	10: 22,148,845	R56S	unknown	Het
Etnk1	A	G	6: 143,195,274	Y248C	probably damaging	Het
Ext1	A	G	15: 53,089,987	S494P	possibly damaging	Het
Gk2	T	C	5: 97,455,720	S420G	probably benign	Het
Gm26596	T	C	10: 112,929,159		probably benign	Het
Gm5414	G	T	15: 101,628,108	N27K	possibly damaging	Het
Gskip	A	G	12: 105,698,729	D9G	probably benign	Het
H2-K2	T	A	17: 33,976,015		noncoding transcript	Het
Hk1	T	G	10: 62,304,779	S105R	probably benign	Het
Hmg20b	T	A	10: 81,348,582	Q129L	probably damaging	Het
Idnk	A	G	13: 58,162,869	D67G	probably benign	Het
Igfbp5	G	T	1: 72,864,063	H118N	probably benign	Het
Irf4	A	T	13: 30,763,597	Y427F	probably benign	Het
Khdc3	A	G	9: 73,102,586	E26G	possibly damaging	Het
Kif7	T	C	7: 79,709,191	D512G	probably damaging	Het
Lamb3	T	A	1: 193,331,357	I513N	probably damaging	Het
Lipo1	A	G	19: 33,783,460	L174P	probably damaging	Het
Lnx1	C	T	5: 74,610,796	V350I	probably benign	Het
Map3k21	A	G	8: 125,942,111	D812G	probably benign	Het
Mast2	G	T	4: 116,314,839	Y637*	probably null	Het
Matn2	T	C	15: 34,428,533	I681T	probably damaging	Het
Med18	A	T	4: 132,462,963	V37D	possibly damaging	Het
Mip	T	A	10: 128,227,053	H122Q	probably benign	Het
Mmp13	A	T	9: 7,274,233	D180V	probably damaging	Het
Mpg	C	A	11: 32,230,034	C187*	probably null	Het
Mtmr14	A	G	6: 113,260,606	E256G	probably benign	Het
Myo7b	C	T	18: 31,967,125		probably null	Het
Nmt1	T	A	11: 103,063,917	V425D	probably damaging	Het
Nynrin	T	A	14: 55,872,894	Y1819*	probably null	Het
Olfr1212	T	A	2: 88,959,212	F249I	probably damaging	Het
Olfr1330	A	G	4: 118,893,950	N289S	possibly damaging	Het
Olfr152	T	C	2: 87,783,221	V227A	possibly damaging	Het
Paqr3	T	A	5: 97,108,210	R102*	probably null	Het
Phc1	T	C	6: 122,321,913	I699V	possibly damaging	Het
Prkdc	T	G	16: 15,816,774	D3594E	probably benign	Het
Pstpip1	A	T	9: 56,125,218	D246V	probably damaging	Het
Rbm46	A	T	3: 82,864,458	D283E	probably benign	Het
Ror2	A	T	13: 53,285,500	C9*	probably null	Het
Setd1b	C	T	5: 123,148,112	A407V	unknown	Het
Slc26a4	T	G	12: 31,540,526	D376A	possibly damaging	Het
Smarcad1	A	G	6: 65,067,089	E215G	probably benign	Het
Spag16	G	A	1: 69,827,035	R11Q	probably null	Het
Sult1d1	T	A	5: 87,566,095	Q30L	probably benign	Het
Tbc1d5	A	G	17: 50,736,223	C746R	probably benign	Het
Tdh	A	G	14: 63,493,756	L323P	possibly damaging	Het
Tet2	A	T	3: 133,488,082	M197K	probably benign	Het
Tnn	T	C	1: 160,146,042	M252V	probably benign	Het
Trdn	G	T	10: 33,195,981	E215*	probably null	Het
Trem1	G	A	17: 48,244,562	V84I	probably benign	Het
Tspan5	T	C	3: 138,898,315	F154L	probably damaging	Het
Usp45	A	G	4: 21,825,044	R647G	probably benign	Het
Usp50	T	A	2: 126,778,033	I120F	probably damaging	Het
Vil1	T	C	1: 74,432,298	M746T	probably benign	Het
Washc4	T	A	10: 83,574,543	M665K	possibly damaging	Het
Zfp750	T	C	11: 121,511,880	T681A	probably benign	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTAGATAGAGCTTCACCTACCC -3'
(R):5'- TTTTCCTCAGCTAGGCCCAG -3'

Sequencing Primer
(F):5'- CACCGGACAGAGCTGGGTATG -3'
(R):5'- TCCCAGGAGTGAGGTTCAG -3'

Posted On

2015-10-08