Incidental Mutation 'R4648:Phc1'
ID 350482
Institutional Source Beutler Lab
Gene Symbol Phc1
Ensembl Gene ENSMUSG00000040669
Gene Name polyhomeotic 1
Synonyms rae28, Mph1, Rae-28, Edr1
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 122294690-122317520 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122298872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 699 (I699V)
Ref Sequence ENSEMBL: ENSMUSP00000124678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000161054] [ENSMUST00000161739] [ENSMUST00000160696] [ENSMUST00000160843] [ENSMUST00000160163]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000007602
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079560
AA Change: I744V
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669
AA Change: I744V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081849
AA Change: I692V
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669
AA Change: I692V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112600
AA Change: I692V
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669
AA Change: I692V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112610
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159252
AA Change: I699V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669
AA Change: I699V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161054
AA Change: I692V
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669
AA Change: I692V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161739
AA Change: I744V
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669
AA Change: I744V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160696
AA Change: I744V
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669
AA Change: I744V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161877
SMART Domains Protein: ENSMUSP00000123854
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160843
SMART Domains Protein: ENSMUSP00000125030
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161290
SMART Domains Protein: ENSMUSP00000125110
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality, posterior skeletal transformations and defects in neural crest derived tissues, including ocular abnormalities, cleft palate, parathyroid and thymic hypoplasia and cardiac anomalies. Hematopoiesis is impaired in fetal livers. [provided by MGI curators]
Allele List at MGI

All alleles(147) : Targeted, knock-out(1) Gene trapped(146)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Phc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Phc1 APN 6 122,299,958 (GRCm39) splice site probably benign
IGL01354:Phc1 APN 6 122,311,042 (GRCm39) missense probably damaging 1.00
IGL01786:Phc1 APN 6 122,296,479 (GRCm39) missense possibly damaging 0.82
IGL02110:Phc1 APN 6 122,298,994 (GRCm39) missense possibly damaging 0.91
IGL02479:Phc1 APN 6 122,300,676 (GRCm39) unclassified probably benign
IGL02861:Phc1 APN 6 122,300,748 (GRCm39) unclassified probably benign
IGL03106:Phc1 APN 6 122,300,428 (GRCm39) unclassified probably benign
3-1:Phc1 UTSW 6 122,315,423 (GRCm39) intron probably benign
FR4737:Phc1 UTSW 6 122,300,557 (GRCm39) small insertion probably benign
FR4976:Phc1 UTSW 6 122,300,559 (GRCm39) small insertion probably benign
R0452:Phc1 UTSW 6 122,299,995 (GRCm39) missense probably damaging 1.00
R1146:Phc1 UTSW 6 122,300,416 (GRCm39) unclassified probably benign
R1146:Phc1 UTSW 6 122,300,416 (GRCm39) unclassified probably benign
R1301:Phc1 UTSW 6 122,302,833 (GRCm39) missense probably benign 0.03
R1738:Phc1 UTSW 6 122,295,525 (GRCm39) missense probably damaging 1.00
R2056:Phc1 UTSW 6 122,310,299 (GRCm39) missense probably damaging 0.99
R2164:Phc1 UTSW 6 122,299,296 (GRCm39) missense possibly damaging 0.82
R2183:Phc1 UTSW 6 122,300,284 (GRCm39) missense probably damaging 1.00
R2424:Phc1 UTSW 6 122,297,002 (GRCm39) missense probably damaging 0.98
R4378:Phc1 UTSW 6 122,311,966 (GRCm39) missense possibly damaging 0.66
R4831:Phc1 UTSW 6 122,313,964 (GRCm39) start gained probably benign
R5244:Phc1 UTSW 6 122,298,938 (GRCm39) missense probably damaging 1.00
R5475:Phc1 UTSW 6 122,311,051 (GRCm39) missense possibly damaging 0.95
R6491:Phc1 UTSW 6 122,311,923 (GRCm39)
R6701:Phc1 UTSW 6 122,302,733 (GRCm39) missense probably damaging 0.96
R6733:Phc1 UTSW 6 122,313,845 (GRCm39) missense possibly damaging 0.77
R7022:Phc1 UTSW 6 122,311,990 (GRCm39) missense probably damaging 0.98
R7383:Phc1 UTSW 6 122,300,317 (GRCm39) missense unknown
R7707:Phc1 UTSW 6 122,300,739 (GRCm39) missense unknown
R7825:Phc1 UTSW 6 122,299,340 (GRCm39) missense probably benign 0.26
R7846:Phc1 UTSW 6 122,310,329 (GRCm39) missense probably damaging 1.00
R8314:Phc1 UTSW 6 122,297,937 (GRCm39) missense unknown
R8346:Phc1 UTSW 6 122,302,774 (GRCm39) missense probably damaging 0.98
R8534:Phc1 UTSW 6 122,315,539 (GRCm39) intron probably benign
RF036:Phc1 UTSW 6 122,300,539 (GRCm39) small insertion probably benign
RF041:Phc1 UTSW 6 122,300,559 (GRCm39) small insertion probably benign
RF044:Phc1 UTSW 6 122,300,559 (GRCm39) small insertion probably benign
RF064:Phc1 UTSW 6 122,300,539 (GRCm39) small insertion probably benign
X0024:Phc1 UTSW 6 122,300,588 (GRCm39) small deletion probably benign
X0026:Phc1 UTSW 6 122,296,497 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGCACCATAATGAACCATTCTCTG -3'
(R):5'- ATCAGGCTTGGTAATGGGCG -3'

Sequencing Primer
(F):5'- GATGATAAAACAGTTGTACCCTTCC -3'
(R):5'- ACATGCGCCTTAATGTGTGC -3'
Posted On 2015-10-08