Incidental Mutation 'R4648:Bbs2'
ID 350488
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene Name Bardet-Biedl syndrome 2
Synonyms 2410125H22Rik
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.674) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 94794582-94825556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94807507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 429 (V429E)
Ref Sequence ENSEMBL: ENSMUSP00000034206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206]
AlphaFold Q9CWF6
Predicted Effect probably damaging
Transcript: ENSMUST00000034206
AA Change: V429E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755
AA Change: V429E

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172347
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94,815,795 (GRCm39) critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94,819,054 (GRCm39) missense probably benign 0.22
IGL02427:Bbs2 APN 8 94,807,746 (GRCm39) missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94,813,539 (GRCm39) missense probably benign 0.00
IGL02850:Bbs2 APN 8 94,803,710 (GRCm39) missense probably benign
IGL03050:Bbs2 APN 8 94,801,041 (GRCm39) splice site probably benign
IGL03292:Bbs2 APN 8 94,801,749 (GRCm39) critical splice donor site probably null
Gosling UTSW 8 94,809,118 (GRCm39) missense possibly damaging 0.95
rolie UTSW 8 94,808,992 (GRCm39) missense probably damaging 0.96
BB007:Bbs2 UTSW 8 94,796,625 (GRCm39) missense probably damaging 1.00
BB017:Bbs2 UTSW 8 94,796,625 (GRCm39) missense probably damaging 1.00
R0755:Bbs2 UTSW 8 94,808,708 (GRCm39) missense probably benign 0.22
R0835:Bbs2 UTSW 8 94,801,887 (GRCm39) missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94,808,627 (GRCm39) missense probably null 0.01
R1404:Bbs2 UTSW 8 94,808,627 (GRCm39) missense probably null 0.01
R1513:Bbs2 UTSW 8 94,816,472 (GRCm39) missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94,807,805 (GRCm39) splice site probably benign
R4876:Bbs2 UTSW 8 94,796,788 (GRCm39) unclassified probably benign
R4911:Bbs2 UTSW 8 94,815,743 (GRCm39) missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94,807,435 (GRCm39) missense probably damaging 1.00
R4982:Bbs2 UTSW 8 94,808,982 (GRCm39) critical splice donor site probably null
R5202:Bbs2 UTSW 8 94,819,042 (GRCm39) nonsense probably null
R5347:Bbs2 UTSW 8 94,819,178 (GRCm39) missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94,801,023 (GRCm39) missense probably benign 0.00
R5538:Bbs2 UTSW 8 94,816,391 (GRCm39) missense probably damaging 1.00
R5685:Bbs2 UTSW 8 94,814,061 (GRCm39) missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94,824,931 (GRCm39) missense probably damaging 0.98
R5963:Bbs2 UTSW 8 94,807,659 (GRCm39) missense probably benign 0.02
R5964:Bbs2 UTSW 8 94,794,995 (GRCm39) missense probably benign 0.18
R5991:Bbs2 UTSW 8 94,824,914 (GRCm39) missense probably benign 0.24
R6050:Bbs2 UTSW 8 94,819,160 (GRCm39) missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94,814,039 (GRCm39) missense probably benign 0.02
R6241:Bbs2 UTSW 8 94,824,863 (GRCm39) critical splice donor site probably null
R6578:Bbs2 UTSW 8 94,803,669 (GRCm39) missense probably null 0.00
R7330:Bbs2 UTSW 8 94,814,033 (GRCm39) missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94,808,992 (GRCm39) missense probably damaging 0.96
R7775:Bbs2 UTSW 8 94,816,388 (GRCm39) critical splice donor site probably null
R7778:Bbs2 UTSW 8 94,816,388 (GRCm39) critical splice donor site probably null
R7824:Bbs2 UTSW 8 94,816,388 (GRCm39) critical splice donor site probably null
R7895:Bbs2 UTSW 8 94,807,764 (GRCm39) missense probably damaging 1.00
R7930:Bbs2 UTSW 8 94,796,625 (GRCm39) missense probably damaging 1.00
R8004:Bbs2 UTSW 8 94,809,118 (GRCm39) missense possibly damaging 0.95
R8084:Bbs2 UTSW 8 94,814,056 (GRCm39) missense probably damaging 1.00
R8305:Bbs2 UTSW 8 94,800,953 (GRCm39) missense probably damaging 1.00
R8545:Bbs2 UTSW 8 94,813,352 (GRCm39) missense probably benign
R9262:Bbs2 UTSW 8 94,807,543 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCTGGTCTGACAGAG -3'
(R):5'- CGCTCTCAGTCAATATGGGG -3'

Sequencing Primer
(F):5'- CCTGGTCTGACAGAGGGCAATG -3'
(R):5'- TGACTTACAAGATGCGCATGC -3'
Posted On 2015-10-08