Incidental Mutation 'R4648:Cmtm4'
ID 350490
Institutional Source Beutler Lab
Gene Symbol Cmtm4
Ensembl Gene ENSMUSG00000096188
Gene Name CKLF-like MARVEL transmembrane domain containing 4
Synonyms Cklfsf4
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105074823-105122439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105082952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000137332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179802]
AlphaFold Q8CJ61
Predicted Effect possibly damaging
Transcript: ENSMUST00000179802
AA Change: I135T

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137332
Gene: ENSMUSG00000096188
AA Change: I135T

DomainStartEndE-ValueType
low complexity region 15 25 N/A INTRINSIC
Pfam:MARVEL 49 170 1.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Cmtm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2056:Cmtm4 UTSW 8 105,081,920 (GRCm39) missense probably damaging 1.00
R2058:Cmtm4 UTSW 8 105,081,920 (GRCm39) missense probably damaging 1.00
R5236:Cmtm4 UTSW 8 105,084,378 (GRCm39) missense probably damaging 1.00
R5638:Cmtm4 UTSW 8 105,084,356 (GRCm39) missense probably benign 0.16
R6181:Cmtm4 UTSW 8 105,082,997 (GRCm39) splice site probably null
R7140:Cmtm4 UTSW 8 105,081,827 (GRCm39) missense probably damaging 1.00
R8993:Cmtm4 UTSW 8 105,081,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCATGCAGAGTGAGCTC -3'
(R):5'- TGCTCTGTATGAATAGCCCTG -3'

Sequencing Primer
(F):5'- GAGTGAGCTCTCTCTATTATCTGAC -3'
(R):5'- GTGGCACAGAGACTTGTGTC -3'
Posted On 2015-10-08