Incidental Mutation 'R4648:Trdn'
ID 350499
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Name triadin
Synonyms triadin 2, triadin 1, 2310045H21Rik, EG432451, triadin-2, triadin-3, triadin-1, triadin 3
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 32959479-33352705 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 33071977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 215 (E215*)
Ref Sequence ENSEMBL: ENSMUSP00000152042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762] [ENSMUST00000217779] [ENSMUST00000219665] [ENSMUST00000219931] [ENSMUST00000219982]
AlphaFold E9Q9K5
Predicted Effect probably null
Transcript: ENSMUST00000095762
AA Change: E215*
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: E215*

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217779
AA Change: E215*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219000
Predicted Effect probably null
Transcript: ENSMUST00000219211
AA Change: E5*
Predicted Effect probably null
Transcript: ENSMUST00000219665
AA Change: E215*
Predicted Effect probably null
Transcript: ENSMUST00000219931
AA Change: E215*
Predicted Effect probably null
Transcript: ENSMUST00000219982
AA Change: E215*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33,347,602 (GRCm39) critical splice donor site probably null
IGL01310:Trdn APN 10 33,181,094 (GRCm39) splice site probably benign
IGL01313:Trdn APN 10 33,076,216 (GRCm39) missense probably damaging 1.00
IGL02177:Trdn APN 10 33,015,169 (GRCm39) missense probably damaging 1.00
IGL02631:Trdn APN 10 33,239,972 (GRCm39) critical splice acceptor site probably null
IGL02732:Trdn APN 10 33,344,195 (GRCm39) splice site probably null
IGL03131:Trdn APN 10 33,274,410 (GRCm39) nonsense probably null
Button UTSW 10 33,350,449 (GRCm39) missense probably damaging 0.97
R0463:Trdn UTSW 10 33,342,417 (GRCm39) critical splice acceptor site probably null
R0610:Trdn UTSW 10 33,350,449 (GRCm39) missense probably damaging 0.97
R0786:Trdn UTSW 10 33,181,077 (GRCm39) missense probably benign 0.22
R0827:Trdn UTSW 10 33,275,154 (GRCm39) splice site probably benign
R1511:Trdn UTSW 10 33,342,448 (GRCm39) missense probably benign 0.18
R1623:Trdn UTSW 10 33,134,098 (GRCm39) missense possibly damaging 0.82
R1760:Trdn UTSW 10 33,109,883 (GRCm39) missense possibly damaging 0.92
R1766:Trdn UTSW 10 33,240,004 (GRCm39) missense probably damaging 1.00
R1884:Trdn UTSW 10 33,133,091 (GRCm39) missense probably benign 0.38
R2297:Trdn UTSW 10 33,211,008 (GRCm39) missense probably damaging 1.00
R2396:Trdn UTSW 10 33,071,978 (GRCm39) missense probably damaging 1.00
R3436:Trdn UTSW 10 33,344,191 (GRCm39) critical splice donor site probably null
R3686:Trdn UTSW 10 33,344,185 (GRCm39) missense probably benign 0.20
R3696:Trdn UTSW 10 33,181,028 (GRCm39) splice site probably null
R3701:Trdn UTSW 10 33,210,980 (GRCm39) missense probably damaging 0.99
R3712:Trdn UTSW 10 33,033,162 (GRCm39) missense probably benign 0.03
R4062:Trdn UTSW 10 33,133,083 (GRCm39) missense probably benign 0.05
R4249:Trdn UTSW 10 33,326,994 (GRCm39) missense probably benign 0.09
R4289:Trdn UTSW 10 33,340,578 (GRCm39) missense probably benign 0.00
R4646:Trdn UTSW 10 33,071,977 (GRCm39) nonsense probably null
R4647:Trdn UTSW 10 33,071,977 (GRCm39) nonsense probably null
R4766:Trdn UTSW 10 33,350,502 (GRCm39) missense probably benign 0.04
R4776:Trdn UTSW 10 33,275,078 (GRCm39) splice site probably null
R4880:Trdn UTSW 10 33,347,575 (GRCm39) missense probably benign 0.26
R4898:Trdn UTSW 10 33,350,413 (GRCm39) missense probably damaging 0.96
R5017:Trdn UTSW 10 33,344,155 (GRCm39) missense probably benign 0.05
R5300:Trdn UTSW 10 33,071,978 (GRCm39) missense probably damaging 1.00
R5320:Trdn UTSW 10 33,209,247 (GRCm39) critical splice donor site probably null
R6089:Trdn UTSW 10 33,340,571 (GRCm39) missense probably benign 0.01
R6216:Trdn UTSW 10 33,181,065 (GRCm39) missense probably damaging 1.00
R6431:Trdn UTSW 10 33,015,110 (GRCm39) missense probably damaging 1.00
R6475:Trdn UTSW 10 33,340,551 (GRCm39) splice site probably null
R6501:Trdn UTSW 10 33,342,450 (GRCm39) missense probably benign 0.02
R6662:Trdn UTSW 10 33,350,483 (GRCm39) missense probably damaging 0.98
R6709:Trdn UTSW 10 33,340,587 (GRCm39) missense probably benign 0.00
R6783:Trdn UTSW 10 33,314,811 (GRCm39) missense probably damaging 0.96
R6906:Trdn UTSW 10 33,109,944 (GRCm39) missense probably benign
R6916:Trdn UTSW 10 33,033,014 (GRCm39) missense probably damaging 1.00
R7291:Trdn UTSW 10 33,313,732 (GRCm39) missense probably null 0.83
R7499:Trdn UTSW 10 33,072,097 (GRCm39) missense probably benign
R7601:Trdn UTSW 10 33,072,152 (GRCm39) missense probably benign 0.00
R7743:Trdn UTSW 10 33,133,058 (GRCm39) nonsense probably null
R8114:Trdn UTSW 10 32,959,624 (GRCm39) start gained probably benign
R8220:Trdn UTSW 10 33,326,981 (GRCm39) missense possibly damaging 0.57
R8228:Trdn UTSW 10 33,033,014 (GRCm39) missense probably damaging 1.00
R8329:Trdn UTSW 10 33,320,074 (GRCm39) splice site probably null
R8918:Trdn UTSW 10 33,015,117 (GRCm39) missense probably benign 0.33
R9304:Trdn UTSW 10 33,181,087 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTCCATGACTTGTATGTC -3'
(R):5'- CAGTTGACTGCATCTGCTTC -3'

Sequencing Primer
(F):5'- TGCCTTTTAAAATGGGACT -3'
(R):5'- GTTGACTGCATCTGCTTCTTGCC -3'
Posted On 2015-10-08