Incidental Mutation 'R4648:Bbs10'
ID 350505
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene Name Bardet-Biedl syndrome 10
Synonyms 1300007O09Rik
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 111134540-111137588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111136995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 703 (K703E)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
AlphaFold Q9DBI2
Predicted Effect probably benign
Transcript: ENSMUST00000040454
AA Change: K703E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: K703E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
chalky UTSW 10 111,135,622 (GRCm39) missense probably damaging 1.00
wampum UTSW 10 111,135,874 (GRCm39) missense probably damaging 1.00
R0097:Bbs10 UTSW 10 111,134,705 (GRCm39) missense probably damaging 1.00
R0117:Bbs10 UTSW 10 111,135,194 (GRCm39) missense possibly damaging 0.94
R0189:Bbs10 UTSW 10 111,136,926 (GRCm39) missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111,135,913 (GRCm39) missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111,135,244 (GRCm39) missense probably damaging 1.00
R1319:Bbs10 UTSW 10 111,134,735 (GRCm39) missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111,135,118 (GRCm39) missense probably damaging 1.00
R2015:Bbs10 UTSW 10 111,136,716 (GRCm39) nonsense probably null
R2361:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R3716:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R3717:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4407:Bbs10 UTSW 10 111,135,720 (GRCm39) missense probably benign 0.00
R4583:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4607:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4607:Bbs10 UTSW 10 111,136,681 (GRCm39) missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4608:Bbs10 UTSW 10 111,136,681 (GRCm39) missense probably damaging 0.99
R4609:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4646:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4647:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4730:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4822:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R4832:Bbs10 UTSW 10 111,136,995 (GRCm39) missense probably benign 0.02
R5056:Bbs10 UTSW 10 111,136,401 (GRCm39) missense probably benign 0.00
R6285:Bbs10 UTSW 10 111,135,622 (GRCm39) missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111,136,965 (GRCm39) missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111,135,310 (GRCm39) missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111,136,628 (GRCm39) nonsense probably null
R7376:Bbs10 UTSW 10 111,135,111 (GRCm39) missense probably benign 0.08
R7701:Bbs10 UTSW 10 111,135,874 (GRCm39) missense probably damaging 1.00
R8146:Bbs10 UTSW 10 111,136,396 (GRCm39) missense probably benign 0.05
R8260:Bbs10 UTSW 10 111,136,104 (GRCm39) nonsense probably null
R8832:Bbs10 UTSW 10 111,136,266 (GRCm39) nonsense probably null
R9656:Bbs10 UTSW 10 111,135,545 (GRCm39) missense probably benign 0.08
Z1176:Bbs10 UTSW 10 111,136,985 (GRCm39) missense probably damaging 1.00
Z1176:Bbs10 UTSW 10 111,135,518 (GRCm39) missense probably benign 0.26
Z1176:Bbs10 UTSW 10 111,134,769 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATACATGCGGTCTCTCCATG -3'
(R):5'- ACTTCAGTCAGCCAGAAGCC -3'

Sequencing Primer
(F):5'- GGTCTCTCCATGCACTGCAAG -3'
(R):5'- GTCTGCGAACATGTGTGTACAAC -3'
Posted On 2015-10-08